159 resultados para MAIN-SEQUENCE STARS
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.
Resumo:
VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.
Resumo:
Sequence specific interaction between DNA and protein molecules has been a subject of active investigation for decades now. Here, we have chosen single promoter containing bacteriophage Delta D-III T7 DNA and Escherichia coli RNA polymerase and followed their recognition at the air-water interface by using the surface plasmon resonance (SPR) technique, where the movement of one of the reacting species is restricted by way of arraying them on an immobilized support. For the Langmuir monolayer studies, we used a RNA polymerase with a histidine tag attached to one of its subunits, thus making it an xcellent substrate for Ni(II) ions, while the SPR Studies were done using biotin-labeled DNA immobilized on a streptavidin-coated chip. Detailed analysis of the thermodynamic parameters as a function of concentration and temperature revealed that the interaction of RNA polymerase with T7 DNA is largely entropy driven (83 (+/- 12) kcal mol(-1)) with a positive enthalpy of 13.6 (+/- 3.6) kcal mol(-1), The free energy of reaction determined by SPR and Langmuir-Blodgett technique was -11 (+/- 2) and -15.6 kcal mol(-1), respectively. The ability of these methods to retain the specificity of the recognition process was also established.
Resumo:
An isolated wind power generation scheme using slip ring induction machine (SRIM) is proposed. The proposed scheme maintains constant load voltage and frequency irrespective of the wind speed or load variation. The power circuit consists of two back-to-back connected inverters with a common dc link, where one inverter is directly connected to the rotor side of SRIM and the other inverter is connected to the stator side of the SRIM through LC filter. Developing a negative sequence compensation method to ensure that, even under the presence of unbalanced load, the generator experiences almost balanced three-phase current and most of the unbalanced current is directed through the stator side converter is the focus here. The SRIM controller varies the speed of the generator with variation in the wind speed to extract maximum power. The difference of the generated power and the load power is either stored in or extracted from a battery bank, which is interfaced to the common dc link through a multiphase bidirectional fly-back dc-dc converter. The SRIM control scheme, maximum power point extraction algorithm and the fly-back converter topology are incorporated from available literature. The proposed scheme is both simulated and experimentally verified.
Resumo:
In recent years, identification of sequence patterns has been given immense importance to understand better their significance with respect to genomic organization and evolutionary processes. To this end, an algorithm has been derived to identify all similar sequence repeats present in a protein sequence. The proposed algorithm is useful to correlate the three-dimensional structure of various similar sequence repeats available in the Protein Data Bank against the same sequence repeats present in other databases like SWISS-PROT, PIR and Genome databases.
Pi-turns in proteins and peptides: Classification, conformation, occurrence, hydration and sequence.
Resumo:
The i + 5-->i hydrogen bonded turn conformation (pi-turn) with the fifth residue adopting alpha L conformation is frequently found at the C-terminus of helices in proteins and hence is speculated to be a "helix termination signal." An analysis of the occurrence of i + 5-->i hydrogen bonded turn conformation at any general position in proteins (not specifically at the helix C-terminus), using coordinates of 228 protein crystal structures determined by X-ray crystallography to better than 2.5 A resolution is reported in this paper. Of 486 detected pi-turn conformations, 367 have the (i + 4)th residue in alpha L conformation, generally occurring at the C-terminus of alpha-helices, consistent with previous observations. However, a significant number (111) of pi-turn conformations occur with (i + 4)th residue in alpha R conformation also, generally occurring in alpha-helices as distortions either at the terminii or at the middle, a novel finding. These two sets of pi-turn conformations are referred to by the names pi alpha L and pi alpha R-turns, respectively, depending upon whether the (i + 4)th residue adopts alpha L or alpha R conformations. Four pi-turns, named pi alpha L'-turns, were noticed to be mirror images of pi alpha L-turns, and four more pi-turns, which have the (i + 4)th residue in beta conformation and denoted as pi beta-turns, occur as a part of hairpin bend connecting twisted beta-strands. Consecutive pi-turns occur, but only with pi alpha R-turns. The preference for amino acid residues is different in pi alpha L and pi alpha R-turns. However, both show a preference for Pro after the C-termini. Hydrophilic residues are preferred at positions i + 1, i + 2, and i + 3 of pi alpha L-turns, whereas positions i and i + 5 prefer hydrophobic residues. Residue i + 4 in pi alpha L-turns is mainly Gly and less often Asn. Although pi alpha R-turns generally occur as distortions in helices, their amino acid preference is different from that of helices. Poor helix formers, such as His, Tyr, and Asn, also were found to be preferred for pi alpha R-turns, whereas good helix former Ala is not preferred. pi-Turns in peptides provide a picture of the pi-turn at atomic resolution. Only nine peptide-based pi-turns are reported so far, and all of them belong to pi alpha L-turn type with an achiral residue in position i + 4. The results are of importance for structure prediction, modeling, and de novo design of proteins.
Resumo:
The complete sequence of a P4 type VP4 gene from a G2 serotype human rotavirus, IS2, isolated in India has been determined. Although the IS2 VP4 is highly homologous to the other P4 type alleles, it contained acidic amino acid substitutions at several positions that make it acidic among the P4 type alleles that are basic. Moreover, comparative sequence analysis revealed unusual polymorphism in members of the P4 type at amino acid position 393 which is highly conserved in members of other VP4 types. To date, expression of complete VP4 inE. coli has not been achieved. In this study we present successful expression inE. coli of the complete VP4 as well as VP8* and VP5* cleavage subunits in soluble form as fusion proteins of the maltose-binding protein (MBP) and their purification by single-step affinity chromatography. The hemagglutinating activity exhibited by the recombinant protein was specifically inhibited by the antiserum raised against it. Availability of pure VP4 proteins should facilitate development of polyclonal and monoclonal antibodies (MAbs) for P serotyping of rotaviruses.
Resumo:
Software packages NUPARM and NUCGEN, are described, which can be used to understand sequence directed structural variations in nucleic acids, by analysis and generation of non-uniform structures. A set of local inter basepair parameters (viz. tilt, roll, twist, shift, slide and rise) have been defined, which use geometry and coordinates of two successive basepairs only and can be used to generate polymeric structures with varying geometries for each of the 16 possible dinucleotide steps. Intra basepair parameters, propeller, buckle, opening and the C6...C8 distance can also be varied, if required, while the sugar phosphate backbone atoms are fixed in some standard conformation ill each of the nucleotides. NUPARM can be used to analyse both DNA and RNA structures, with single as well as double stranded helices. The NUCGEN software generates double helical models with the backbone fixed in B-form DNA, but with appropriate modifications in the input data, it can also generate A-form DNA ar rd RNA duplex structures.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA- treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had not detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These date indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.
Resumo:
Transfer RNAs of Azospirillum lipoferum were separated by two- dimensional gel electrophoresis and identified by aminoacylation. Thirty-six tRNA spots were resolved by this technique and twenty-six tRNA species have been identified. There are five tRNAs for Leu, four for Val, three for Pro, two each for Arg, Ile, Lys and Tyr, and one each for Ala, Asp, His, Phe, Ser and Thr. The tRNA(Asn) (QUU) was purified and its nucleotide sequence was determined. The A. lipoferum tRNA(Asn) (QUU) is 92% similar to B. subtilis tRNA(Asn) gene and two hypermodified nucleosides, queuosine (Q) and N-(9-beta-D Ribofuranosylpurine-6-YL) carbamoyl)-threonine (t(6)A) are present in this tRNA.
Resumo:
Study of the evolution of species or organisms is essential for various biological applications. Evolution is typically studied at the molecular level by analyzing the mutations of DNA sequences of organisms. Techniques have been developed for building phylogenetic or evolutionary trees for a set of sequences. Though phylogenetic trees capture the overall evolutionary relationships among the sequences, they do not reveal fine-level details of the evolution. In this work, we attempt to resolve various fine-level sequence transformation details associated with a phylogenetic tree using cellular automata. In particular, our work tries to determine the cellular automata rules for neighbor-dependent mutations of segments of DNA sequences. We also determine the number of time steps needed for evolution of a progeny from an ancestor and the unknown segments of the intermediate sequences in the phylogenetic tree. Due to the existence of vast number of cellular automata rules, we have developed a grid system that performs parallel guided explorations of the rules on grid resources. We demonstrate our techniques by conducting experiments on a grid comprising machines in three countries and obtaining potentially useful statistics regarding evolutions in three HIV sequences. In particular, our work is able to verify the phenomenon of neighbor-dependent mutations and find that certain combinations of neighbor-dependent mutations, defined by a cellular automata rule, occur with greater than 90% probability. We also find the average number of time steps for mutations for some branches of phylogenetic tree over a large number of possible transformations with standard deviations less than 2.
Resumo:
We present a new method for establishing correlation between deuterium and its attached carbon in a deuterated liquid crystal. The method is based on transfer of polarization using the DAPT pulse sequence proposed originally for two spin half nuclei, now extended to a spin-1 and a spin-1/2 nuclei. DAPT utilizes the evolution of magnetization of the spin pair under two blocks of phase shifted BLEW-12 pulses on one of the spins separated by a 90 degree pulse on the other spin. The method is easy to implement and does not need to satisfy matching conditions unlike the Hartmann-Hahn cross-polarization. Experimental results presented demonstrate the efficacy of the method.
Resumo:
Restriction endonucleases (REases) protect bacteria from invading foreign DNAs and are endowed with exquisite sequence specificity. REases have originated from the ancestral proteins and evolved new sequence specificities by genetic recombination, gene duplication, replication slippage, and transpositional events. They are also speculated to have evolved from nonspecific endonucleases, attaining a high degree of sequence specificity through point mutations. We describe here an example of generation of exquisitely site-specific REase from a highly-promiscuous one by a single point mutation.