31 resultados para cucumber cotyledons
Resumo:
Arginine decarboxylase (arginine carboxy-lyase EC 4.1.1.19) of Cucumis sativus cotyledons, has a pH optimum of 8.3 and a temperature optimum of 40°. Among the various plant hormones administered to excised cotyledons in culture, benzyladenine and its riboside were most effective in increasing the arginine decarboxylase activity and putrescine content. The enzyme activity and putrescine content were significantly increased on acid feeding of the cotyledons and decreased by KCl treatment. The KCl effect could be only partially reversed by benzyladenine. Abscisic acid inhibited cotyledon growth and also reduced arginine decarboxylase and putrescine levels. This effect was overcome by cytokinins. The half life of the enzyme using cycloheximide was 3.7 hr. Dibutyryl cyclic AMP and 5′-AMP also marginally stimulated the enzyme and putrescine levels. Mixing experiments indicate that there is neither a non-dialysable activator nor inhibitor of the enzyme.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
We have determined relative levels of chloroplast leucine and tyrosine isoaccepting tRNAs and modified nucleotide contents from total tRNAs isolated from dark-grown, light-grown, N6-isopentenyladenine (i6A)-treated dark-grown and i6A-treated light-grown cucumber seedlings. Significant increases in the relative amounts of tRNA(Leu)2 and tRNA(Leu)3 were observed in the i6A-treated dark-grown seedlings compared to dark-grown, light-grown and i6A-treated light-grown seedlings. On the other hand, i6A-treated light-grown seedlings tRNA(Tyr)1 increased to 85% of total tRNAs(Tyr) from about 9% in light-grown seedlings and tRNA(Tyr)2 decreased to 15% compared with 91% in light-grown seedlings. Analysis of modified nucleotide of total tRNAs indicated that pT, pI, pm1A, pm5C, pGm, pm1G, pm2G and pm7G contents were significantly higher in the total tRNA of i6A-treated dark-grown seedlings than those from untreated dark-grown seedlings. Illumination of 8-day-old dark-grown seedlings for 12 h increased the contents of pT, pI, pGm and pm1G when compared to 8-day-old dark-grown seedlings with extended growth for 12 h in dark. On the contrary, i6A had no stimulatory effect in the contents of modified nucleotide in the light-grown seedlings.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA- treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had not detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These date indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.
Resumo:
The genomic sequences of several RNA plant viruses including cucumber mosaic virus, brome mosaic virus, alfalfa mosaic virus and tobacco mosaic virus have become available recently. The former two viruses are icosahedral while the latter two are bullet and rod shaped, respectively in particle morphology. The non-structural 3a proteins of cucumber mosaic virus and brome mosaic virus have an amino acid sequence homology of 35% and hence are evolutionarily related. In contrast, the coat proteins exhibit little homology, although the circular dichroism spectrum of these viruses are similar. The non-coding regions of the genome also exhibit variable but extensive homology. Comparison of the brome mosaic virus and alfalfa mosaic virus sequences reveals that they are probably related although with a much larger evolutionary distance. The polypeptide folds of the coat protein of three biologically distinct isometric plant viruses, tomato bushy stunt virus, southern bean mosaic virus and satellite tobacco necrosis virus have been shown to display a striking resemblance. All of them consist of a topologically similar 8-standard β-barrel. The implications of these studies to the understanding of the evolution of plant viruses will be discussed.
Resumo:
A new guanidino amine has been isolated from Lathyrus sativus seedlings and chararterized as homoagmatine on the basis of various physico-chemical criteria including IR spectrum and comparison with that chemically synthesized. Homoagmatine is accumulated in the embryos axis while its precursor, homoarginine, is lost from the cotyledons. However, there was a progressive increase in homoarginine content of the embryo axis during development. Since the amine content of the whole seedlings corresponded to nearly 20–25 % of net decrease in homoarginine levels, it is concluded that the catabolism of homoarginine through homoagmatine represents a major pathway of metabolism of the arnino acid.
Resumo:
The biosynthesis of certain amines in Lathyrus sativus seedlings was studied in isolated shoots and cotyledons. In shoots, arginine was about 14 times more efficient than ornithine for the synthesis of agmatine, putrescine, spermidine and spermine. Isotope dilution experiments, and the changes in specific activities of the 4 amines with time when 14C-arginine served as the precursor, indicated that putrescine and the polyamines were formed mainly from arginine, via agmatine. Similar experiments showed that cadaverine was formed at least in part from homoarginine, though lysine was ca 4 times more effective as a precursor. The pattern of changes in specific activity of homoagmatine and cadaverine with time when 14C-homoarginine served as the precursor support the conclusion that homoarginine and arginine follow analogous metabolic routes in the biosynthesis of putrescine and cadaverine respectively.
Resumo:
Arginine decarboxylase which makes its appearance in Lathyrus sativus seedlings after 24 h of seed germination reaches its highest level around 5–7 days, the cotyledons containing about 60% of the total activity in the seedlings at day 5. The cytosol enzyme was purified 977-fold from whole seedlings by steps involving manganese chloride treatment, ammonium sulphate and acetone fractionations, positive adsorption on alumina C-γ gel, DEAE-Sephadex chromatography followed by preparative disc gel electrophoresis. The enzyme was shown to be homogeneous by electrophoretic and immunological criteria, had a molecular weight of 220000 and appears to be a hexamer with identical subunits. The optimal pH and temperature for the enzyme activity were 8.5 and 45 °C respectively. The enzyme follows typical Michaelis-Menten kinetics with a Km value of 1.73 mM for arginine. Though Mn2+ at lower concentrations stimulated the enzyme activity, there was no dependence of the enzyme on any metal for the activity. The arginine decarboxylase of L. sativus is a sulfhydryl enzyme. The data on co-factor requirement, inhibition by carbonyl reagents, reducing agents and pyridoxal phosphate inhibitors, and a partial reversal by pyridoxal phosphate of inhibition by pyridoxal · HCl suggests that pyridoxal 5'-phosphate is involved as a co-factor for the enzyme. The enzyme activity was inhibited competitively by various amines including the product agmatine. Highest inhibition was obtained with spermine and arcain. The substrate analogue, l-canavanine, homologue l-homoarginine and other basic amino acids like l-lysine and l-ornithine inhibited the enzyme activity competitively, homoarginine being the most effective in this respect.
Resumo:
In growing Lathyrus sativus seedlings, the levels of DNA, RNA and protein markedly decreased in the cotyledons and progressively increased in the embryo-axis. In cotyledons, spermidine and spermine contents were substantially reduced while those of agmatine and putrescine were sharply increased. By contrast the embryo-axis progressively accumulated relatively larger amounts of agmatine, homoagmatine. putrescine, cadaverine, spermidine and spermine in parallel with similar changes in its DNA, RNA and protein content. While the cotyledons contained ca 50% of the total agmatine and putrescine present in the plant embryo by day 10, the embryo-axis, though representing less than 20% of the dry wt, contained 90 and 75% of total cadaverine and homoagmatine respectively of the seedlings. Spermidine and spermine levels of this tissue were also comparatively higher, being of the order of 80 and 50% respectively of the total. The root and shoot portions of the embryo-axis also exhibited a similar relationship between changes in DNA, RNA and protein and all the above amines during development. However, the polyamine content of the shoots was relatively higher than those of the roots during the growth period.
Resumo:
Plant regeneration from mesophyll protoplasts of pepper, Capsicum annuum L. cv. California Wonder has been demonstrated via shoot organogenesis, Protoplasts isolated from fully expanded leaves of 3-week-old axenic shoots when cultured in TM medium supplemented with 1 mgl(-1) NAA, 1 mgl(-1) 2, 4-D, 0.5 mgl(-1) BAP (CM 1) resulted in divisions with a frequency ranging from 20-25%. Antioxidant ascorbic acid and polyvinylpyrrolidone (PVP) in the medium and incubation in the dark helped overcome browning of protoplasts. Microcalli and macrocalli were formed in TM medium containing 2 mgl(-1) NAA and 0.5 mgl(-1) BAP (CM II) and MS gelled medium containing 2 mgl(-1) NAA and 0.5 mgl(-1) BAP (CM III), respectively, Regeneration of plantlets was possible via caulogenesis, Microshoots, 2-5 per callus appeared on MS gelled medium enriched with 0.5 mgl(-1) IAA, 2 mgl(-1) GA and 10 mgl(-1) BAP (CM IVc). Rooting of microshoots was obtained on half strength gelled medium containing 1 mgl(-1) NAA and 0.5 mgl(-1) BAP, Protoplasts isolated from cotyledons failed to divide and degenerated eventually.
Resumo:
Callus cultures were established from hypocotyls and cotyledons derived from young seedlings of Eucalyptus citriodora. Successful plantlet production from cotyledonary callus was achieved within 6 weeks on Murashige and Skoog's basal medium supplemented with zeatin (1 mg/l) and indoleacetic acid (0.2 mg/l). Leaf and shoot callus obtained from one-year-old plants did not differentiate. Results reported contribute to defining optimal conditions for callus growth and plantlet formation
Resumo:
Synthesis of peanut agglutinin was induced in callus and cell suspension cultures of cotyledons of peanut (Arachis hypogaea L.). The lectin was synthesised in cultures through several passages. Biosynthesis of peanut agglutinin was regulated by the type and concentration of exogenous growth regulators and was positively correlated to the growth of the cultures,indicating that the agglutinin may have a role to play during cell growth. Movement of agglutinin from the cells into the medium not only facilitated easy isolation of the lectin but also provided a clue that it may probably serve as a defence molecule. The synthesized lectin purified from culture, was found to be biologically active, and was found to be comparable with the lectin from seeds, in terms of its electrophoretic mobility.