131 resultados para 143-870


Relevância:

10.00% 10.00%

Publicador:

Resumo:

The standard Gibbs energy change accompanying the conversion of rare earth oxides to oxysulfides by reaction of rare earth oxides with diatomic sulfur gas has been measured in the temperature range 870 to 1300 K using the solid state cell: Pt/Cu+Cu2S/R2O2S+R2O3‖(CaO)ZrO2‖Ni+NiO, Pt where R=La, Nd, Sm, Gd, Tb, and Dy. The partial pressure of diatomic sulfur over a mixture of rare earth oxide (R2O3) and oxysulfide (R2O2S) is fixed by the dissociation of Cu2S to Cu in a closed system. The buffer mixture of Cu+Cu2S is physically separated from the rare earth oxide and oxysulfide to avoid complications arising from interaction between them. The corresponding equilibrium oxygen partial pressure is measured with an oxide solid electrolyte cell. Gibbs energy change for the conversion of oxide to the corresponding oxysulfide increases monotonically with atomic number of the rare earth element. Second law enthalpy of formation also shows a similar trend. Based on this empirical trend Gibbs energies of formation of oxysulfides of Pr, Eu, Ho, and Er are estimated as a function of temperature.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

35Cl NQR has been investigated in two cyclotriphosphazene derivatives N3P3Cl4Ph2 and N3P3Cl4(NMe2)2. The observed frequencies are assigned to the various chlorines and the temperature variation of the NQR frequencies studied in the range from 77 K to 300 K. The results are analysed using the Bayer-Kushida-Brown approach. Torsional (librational) frequencies are found to fall in the range 10–25 cm−1 and are found to be only slightly temperature dependent.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

NMR studies of methyldichlorophosphine have been undertaken in the nematic phase of mixed liquid crystals of opposite diamagnetic anisotropies. The rα structure is derived. The proton chemical-shift anisotropy has been determined from the studies without the use of a reference compound and without a change of experimental conditions. It is shown that the molecule orients in the liquid crystal with positive diamagnetic anisotropy in such a way that the C3 symmetry axis of the CH3P moiety is preferentially aligned perpendicular to the direction of the magnetic field, unlike other similar systems. This is interpreted in terms of the formation of a weak solvent-solute molecular complex. The heteronuclear indirect spin-spin coupling constants are determined. The sign of the two-bond JPH is found to be positive.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Abstract is not available.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

One of the important developments in rotary wing aeroelasticity in the recent past has been the growing awareness and acceptance of the fact that the problem is inherently non-linear and that correct treatment of aeroelastic problems requires the development of a consistent mathematical model [l]. This has led to a number of studies devoted to the derivation of a consistent set of “second order” non-linear equations, for example, those of Hodges and Dowel1 [2], of Rosen and Friedmann [3], and of Kvaternik, White and Kaza [4], each of which differs from the others on the question of the inclusion of certain terms in the equations of motion. The final form of the equations depends first upon the ordering scheme used for characterizing the displacements and upon the consistency with which this is applied in omitting terms of lower order. The ideal way of achieving this would be to derive the equations of motion with all the terms first included regardless of their relative orders of magnitude and then to apply the ordering scheme.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Abstaract is not available.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Magnetic susceptibilities of several members of the series of oxides of the general formula LaNi1-xMxO3 (M = Cr, Fe, or Co) are reported. The oxides show evidence for interesting ferrimagnetic (Cr and Co) and antiferromagnetic (Fe) interactions.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A mono-oxygenase catalysing the conversion of 2-ethyl-4-thioisonicotinamide (ethionamide) into its sulphoxide was purified from guinea-pig liver homogenates. The enzyme required stoicheiometric amounts of oxygen and NADPH for the sulphoxidation reaction. The purified protein is homogeneous by electrophoretic, antigenic and chromatographic criteria. The enzyme has mol.wt. 85000 and it contains 1g-atom of iron and 1mol of FAD per mol, but not cytochrome P-450. The enzyme shows maximal activity at pH7.4 in a number of different buffer systems and the Km values calculated for the substrate and NADPH are 6.5×10-5m and 2.8×10-5m respectively. The activation energy of the reaction was calculated to be 36kJ/mol. Under optimal conditions, the molecular activity of the enzyme (mol of substrate oxidized/min per mol of enzyme) is calculated to be 2.1. The oxygenase belongs to the class of general drug-metabolizing enzymes and it may act on different compounds which can undergo sulphoxidation. The mechanism of sulphoxidation was shown to be mediated by superoxide anions.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The electrical activation energy and optical band-gap of GeSe and GeSbSe thin films prepared by flash evaporation on to glass substrates have been determined. The conductivities of the films were found to be given by Image , the activation energy Ea being 0.53 eV and 0.40 eV for GeSe and GeSbSe respectively. The optical absorption constant α near the absorption edge could be described by Image from which the optical band-gaps E0 were found to be 1.01 eV for GeSe and 0.67 eV for GeSbSe at 300°K. At 110°K the corresponding values of E0 were 1.07 eV and 0.735 eV respectively. The significance of these values is discussed in relation to those of other amorphous semiconductors.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

M r=670.02, monoclinic, C2/c, a= 31.003(4), b=11.037(2), c=21.183(3)A, fl= 143.7 (1) °, V= 4291.2/k 3, D,n = 2.06, D x = 2.07Mgm -3, Z=8, MoKa, 2=0.7107/k, /~=7.45 mm -1, F(000) = 2560, T= 293 K, R = 0.061 for 1697 observed reflections. The bromphenol blue molecule consists essentially of three planar groupings: the sulfonphthalein ring system and two dibromophenol rings attached to the tetrahedral C atom of the five-membered ring of the sulfonphthalein system. The dibromophenol rings are inclined with resPect to each other at 73 ° whereas they make angles of 85 and 68 ° with respect to the sulfonphthalein system. The molecules aggregate into helical columns with the non-polar regions of the molecules in the interior and the polar regions on the surface. The columns are held together by a network of hydrogen bonds.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Townsend's first ionization coefficients have been measured in corssed electric and magnetic fields for values of B/p ranging from 0.013 TESLA. TORR-1 to 0.064 TESLA.TORR-1 and for 103 x 102¿ E/p 331 x 102 V.M-1. TORR-1 in oxygen and for 122 x 102¿ E/pÂ488 x 102 V.M-1.TORR-1 for dry air. The values of effective collision frequencies determined from the equivalent pressure (pe) concept generally increase with E/p at constant B/p and decrease with increasing B/p at constant E/p. Effective collision frequencies determined from measured sparking potentials at high values of E/p increase with decreasing E/pe. The drift velocity and mean energy of electrons in oxygen in crossed electric and magnetic fields have been derived.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Abstract is not available.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Crystalline complexes of succinic acid with DL- and L-lysine have been prepared and analysed by X-ray diffraction. DL-Lysine complex: C6HIsN202 + 1 2- 1 ~C4H404 .~C4H604, Mr -- 264"2, PI, a = 5"506 (4), =8.070(2), c=14.089(2) A,, a=92.02(1), /3= 100"69 (3), y = 95"85 (3) ~>, Z = 2, Dx = 1"44 g cm -3, R = 0.059 for 2546 observed reflections. Form I of the e-lysine complex: C6HIsN20-, ~ .C4H504, Mr = 264.2, P1, a = 5" 125 (2), b = 8"087 (1), c = 8"689 (1) A,, a = 112.06 (1), /3 = 99.08 (2), y = 93"77(2) °, Z--l, D,,,=1"34(3), Dx=l"34gcm 3 R = 0.033 for 1475 observed reflections. Form II of + I 2- the e-lysine complex: C6H15N202 .,iC4H404 .- 1 I ") 4C4H604.4(C4HsO4""H'"CaH404)" , Mr = 264"2, P1, a = 10.143 (4), b = 10.256 (2), c = 12"916 (3) A,, a = 105.00 (2),/3 = 99-09 (3), y = 92"78 (3)::, Z = 4, Dm= 1"37(4), D,.= 1.38gcm 3, R=0.067 for 2809 observed reflections. The succinic acid molecules in the structures exhibit a variety of ionization states. Two of the lysine conformations found in the complexes have been observed for the first time in crystals containing lysine. Form II of the L-lysine complex is highly pseudosymmetric. In all the complexes, unlike molecules aggregate into separate alternating layers. The basic element of aggregation in the lysine layer in the complexes is an S2-type head-to-tail sequence. This element combines in different ways in the three structures. The basic element of aggre gation in the succinic acid layer in the complexes is a hydrogen-bonded ribbon. The ribbons are interconnected indirectly through amino groups in the lysine layer.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The PRP17 gene product is required for the second step of pre-mRNA splicing reactions. The C-terminal half of this protein bears four repeat units with homology to the beta transducin repeat. Missense mutations in three temperature-sensitive prp17 mutants map to a region in the N-terminal half of the protein. We have generated, in vitro, 11 missense alleles at the beta transducin repeat units and find that only one affects function in vivo. A phenotypically silent missense allele at the fourth repeat unit enhances the slow-growing phenotype conferred by an allele at the third repeat, suggesting an interaction between these domains. Although many missense mutations in highly conserved amino acids lack phenotypic effects, deletion analysis suggests an essential role for these units. Only mutations in the N-terminal nonconserved domain of PRP17 are synthetically lethal in combination with mutations in PRP16 and PRP18, two other gene products required for the second splicing reaction. A mutually allele-specific interaction between Prp17 and snr7, with mutations in U5 snRNA, was observed. We therefore suggest that the functional region of Prp17p that interacts with Prp18p, Prp16p, and U5 snRNA is the N terminal region of the protein.