On the axial vibrations of rotating bars

One of the important developments in rotary wing aeroelasticity in the recent past has been the growing awareness and acceptance of the fact that the problem is inherently non-linear and that correct treatment of aeroelastic problems requires the development of a consistent mathematical model [l]. This has led to a number of studies devoted to the derivation of a consistent set of “second order” non-linear equations, for example, those of Hodges and Dowel1 [2], of Rosen and Friedmann [3], and of Kvaternik, White and Kaza [4], each of which differs from the others on the question of the inclusion of certain terms in the equations of motion. The final form of the equations depends first upon the ordering scheme used for characterizing the displacements and upon the consistency with which this is applied in omitting terms of lower order. The ideal way of achieving this would be to derive the equations of motion with all the terms first included regardless of their relative orders of magnitude and then to apply the ordering scheme.

The study of oxidation state of manganese in lead oxyhalide glasses by optical spectroscopy

Abstaract is not available.

Magnetic interactions in the oxide systems LaNi1-xMxO3 (M = Cr, Fe, or Co)

Magnetic susceptibilities of several members of the series of oxides of the general formula LaNi1-xMxO3 (M = Cr, Fe, or Co) are reported. The oxides show evidence for interesting ferrimagnetic (Cr and Co) and antiferromagnetic (Fe) interactions.

An oxygenase from guinea-pig liver which catalyses sulphoxidation

A mono-oxygenase catalysing the conversion of 2-ethyl-4-thioisonicotinamide (ethionamide) into its sulphoxide was purified from guinea-pig liver homogenates. The enzyme required stoicheiometric amounts of oxygen and NADPH for the sulphoxidation reaction. The purified protein is homogeneous by electrophoretic, antigenic and chromatographic criteria. The enzyme has mol.wt. 85000 and it contains 1g-atom of iron and 1mol of FAD per mol, but not cytochrome P-450. The enzyme shows maximal activity at pH7.4 in a number of different buffer systems and the Km values calculated for the substrate and NADPH are 6.5×10-5m and 2.8×10-5m respectively. The activation energy of the reaction was calculated to be 36kJ/mol. Under optimal conditions, the molecular activity of the enzyme (mol of substrate oxidized/min per mol of enzyme) is calculated to be 2.1. The oxygenase belongs to the class of general drug-metabolizing enzymes and it may act on different compounds which can undergo sulphoxidation. The mechanism of sulphoxidation was shown to be mediated by superoxide anions.

Electrical and optical properties of amorphous semiconducting GeSe and GeSbSe films

The electrical activation energy and optical band-gap of GeSe and GeSbSe thin films prepared by flash evaporation on to glass substrates have been determined. The conductivities of the films were found to be given by Image , the activation energy Ea being 0.53 eV and 0.40 eV for GeSe and GeSbSe respectively. The optical absorption constant α near the absorption edge could be described by Image from which the optical band-gaps E0 were found to be 1.01 eV for GeSe and 0.67 eV for GeSbSe at 300°K. At 110°K the corresponding values of E0 were 1.07 eV and 0.735 eV respectively. The significance of these values is discussed in relation to those of other amorphous semiconductors.

3,3',5,5'-Tetrabromophenolsulfonphthalein (bromphenol blue), C19H10Br4O5S

M r=670.02, monoclinic, C2/c, a= 31.003(4), b=11.037(2), c=21.183(3)A, fl= 143.7 (1) °, V= 4291.2/k 3, D,n = 2.06, D x = 2.07Mgm -3, Z=8, MoKa, 2=0.7107/k, /~=7.45 mm -1, F(000) = 2560, T= 293 K, R = 0.061 for 1697 observed reflections. The bromphenol blue molecule consists essentially of three planar groupings: the sulfonphthalein ring system and two dibromophenol rings attached to the tetrahedral C atom of the five-membered ring of the sulfonphthalein system. The dibromophenol rings are inclined with resPect to each other at 73 ° whereas they make angles of 85 and 68 ° with respect to the sulfonphthalein system. The molecules aggregate into helical columns with the non-polar regions of the molecules in the interior and the polar regions on the surface. The columns are held together by a network of hydrogen bonds.

Townsend's First Ionization Coefficients and Sparking Potentials in Crossed Electric and Magnetic Fields

Townsend's first ionization coefficients have been measured in corssed electric and magnetic fields for values of B/p ranging from 0.013 TESLA. TORR-1 to 0.064 TESLA.TORR-1 and for 103 x 102¿ E/p 331 x 102 V.M-1. TORR-1 in oxygen and for 122 x 102¿ E/pÂ488 x 102 V.M-1.TORR-1 for dry air. The values of effective collision frequencies determined from the equivalent pressure (pe) concept generally increase with E/p at constant B/p and decrease with increasing B/p at constant E/p. Effective collision frequencies determined from measured sparking potentials at high values of E/p increase with decreasing E/pe. The drift velocity and mean energy of electrons in oxygen in crossed electric and magnetic fields have been derived.

Role of F-gravity in cosmological models

Abstract is not available.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

X-ray studies on crystalline complexes involving amino acids and peptides. XXIII. Variability in ionization state, conformation and molecular aggregation in the complexes of succinic acid with DL- and L-lysine

Crystalline complexes of succinic acid with DL- and L-lysine have been prepared and analysed by X-ray diffraction. DL-Lysine complex: C6HIsN202 + 1 2- 1 ~C4H404 .~C4H604, Mr -- 264"2, PI, a = 5"506 (4), =8.070(2), c=14.089(2) A,, a=92.02(1), /3= 100"69 (3), y = 95"85 (3) ~>, Z = 2, Dx = 1"44 g cm -3, R = 0.059 for 2546 observed reflections. Form I of the e-lysine complex: C6HIsN20-, ~ .C4H504, Mr = 264.2, P1, a = 5" 125 (2), b = 8"087 (1), c = 8"689 (1) A,, a = 112.06 (1), /3 = 99.08 (2), y = 93"77(2) °, Z--l, D,,,=1"34(3), Dx=l"34gcm 3 R = 0.033 for 1475 observed reflections. Form II of + I 2- the e-lysine complex: C6H15N202 .,iC4H404 .- 1 I ") 4C4H604.4(C4HsO4""H'"CaH404)" , Mr = 264"2, P1, a = 10.143 (4), b = 10.256 (2), c = 12"916 (3) A,, a = 105.00 (2),/3 = 99-09 (3), y = 92"78 (3)::, Z = 4, Dm= 1"37(4), D,.= 1.38gcm 3, R=0.067 for 2809 observed reflections. The succinic acid molecules in the structures exhibit a variety of ionization states. Two of the lysine conformations found in the complexes have been observed for the first time in crystals containing lysine. Form II of the L-lysine complex is highly pseudosymmetric. In all the complexes, unlike molecules aggregate into separate alternating layers. The basic element of aggregation in the lysine layer in the complexes is an S2-type head-to-tail sequence. This element combines in different ways in the three structures. The basic element of aggre gation in the succinic acid layer in the complexes is a hydrogen-bonded ribbon. The ribbons are interconnected indirectly through amino groups in the lysine layer.

Genetic studies of the PRP17 gene of Saccharomyces cerevisiae: a domain essential for function maps to a nonconserved region of the protein

The PRP17 gene product is required for the second step of pre-mRNA splicing reactions. The C-terminal half of this protein bears four repeat units with homology to the beta transducin repeat. Missense mutations in three temperature-sensitive prp17 mutants map to a region in the N-terminal half of the protein. We have generated, in vitro, 11 missense alleles at the beta transducin repeat units and find that only one affects function in vivo. A phenotypically silent missense allele at the fourth repeat unit enhances the slow-growing phenotype conferred by an allele at the third repeat, suggesting an interaction between these domains. Although many missense mutations in highly conserved amino acids lack phenotypic effects, deletion analysis suggests an essential role for these units. Only mutations in the N-terminal nonconserved domain of PRP17 are synthetically lethal in combination with mutations in PRP16 and PRP18, two other gene products required for the second splicing reaction. A mutually allele-specific interaction between Prp17 and snr7, with mutations in U5 snRNA, was observed. We therefore suggest that the functional region of Prp17p that interacts with Prp18p, Prp16p, and U5 snRNA is the N terminal region of the protein.

Polypyrrole based amperometric glucose biosensors

Biosensors have gained immense acceptance in the field of medical diagnostics, besides environmental, food safety and biodefence applications due to its attributes of real-time and rapid response. This synergistic combination of biotechnology and microelectronics comprises a biological recognition element coupled with a compatible transducer device. Diabetes is a disease of major concern since the ratio of world population suffering from it is increasing at an alarming rate and therefore the need for development of accurate and stable glucose biosensors is evident. There are many commercial glucose biosensors available yet some limitations need attention. This review presents a detailed account of the polypyrrole based amperometric glucose biosensors. The polymer polypyrrole is used extensively as a matrix for immobilization of glucose oxidase enzyme owing to its favourable features such as stability under ambient conditions, conductivity that allows it to be used as an electron relay, ability to be polymerized under neutral and aqueous mild conditions, and more. The simple one-step electrodeposition on the electrode surface allows easy entrapment of the enzyme. The review is structured into three categories (a) the first-stage biosensors: which report the studies from the inception of use of polypyrrole in glucose biosensors during which time the role of the polymer and the use of mediators was established. This period saw extensive work by two separate groups of Schuhmann and Koopal who contributed a great deal in understanding the electron transfer pathways in polypyrrole based glucose biosensors, (b) the second-stage biosensors: which highlight the shift of polypyrrole from a conventional matrix to composite matrices with extensive use of mediators focused at improving the selectivity of response, and (c) third-stage biosensors: the remarkable properties of nanoparticles and carbon nanotubes and their outstanding ability to mediate electrontransfers have seen their indispensable use in conjugation with polypyrrole for development of glucose biosensors with improved sensitivity and stability characteristics which is accounted in the review, which thus traces the evolution of polypyrrole from a conventional matrix, to composites and thence to the form of nanotube arrays, with the objective of addressing the vital issue of diabetes management through the development of stable and reliable glucose biosensors.

Effect of thione—thiol tautomerism on the inhibition of lactoperoxidase by anti-thyroid drugs and their analogues

The keto-enol type tautomerism in anti-thyroid drugs and their selenium analogues are described. The commonly used anti-thyroid drug methimazole exists predominantly in its thione form, whereas its selenium analogue exists in a zwitterionic form. To understand the effect of thione/thiol and selone/selenol tautomerism on the inhibition of peroxidase-catalysed reactions, we have synthesized some thiones and selones in which the formation of thiol/selenol forms are blocked by different substituents. These compounds were synthesized by a carbene route utilizing an imidazolium salt. The crystal structures of these compounds reveal that the C=Se bonds in the selones are more polarized than the C=S bonds in the corresponding thiones. The structures of selones were studied in solution by NMR spectroscopy and the 77Se NMR chemical shifts for the selones show large upfield shifts in the signals, confirming their zwitterionic structures in solution. The inhibition of lactoperoxidase by the synthetic thiones indicates that the presence of a free N-H moiety is essential for an efficient inhibition. In contrast, such moiety is not required for an inhibition by the selenium compounds.

Influence of magnetic clusters on electrical and magnetic properties of In1-xMnxSb/GaAs dilute magnetic semiconductor grown by liquid phase epitaxy

In1-xMnxSb films have been grown with different Mn doping concentrations (x = 0.0085, 0.018, 0.029 and 0.04) beyond the equilibrium 14 solubility limit by liquid phase epitaxy. We have studied temperature dependent resistivity, the Hall effect, magnetoresistance and magnetization for all compositions. Saturation in magnetization observed even at room temperature suggests the existence of ferromagnetic clusters in the film which has been verified by scanning electron microscopy studies. The anomalous Hall coefficient is found to be negative. Remnant field present on the surface of the clusters seems to affect the anomalous Hall effect at very low fields (below 350 Gauss). In the zero field resistivity, a variable-range hopping conduction mechanism dominates below 3.5 K for all samples above which activated behavior is predominant. The temperature dependence of the magnetization measurement shows a magnetic ordering below 10 K which is consistent with electrical measurements. (c) 2007 Elsevier Ltd. All rights reserved.

Optimum design of cantilever sheet pile walls in sandy soils using inverse reliability approach

In this paper an approach for obtaining depth and section modulus of the cantilever sheet pile wall using inverse reliability method is described. The proposed procedure employs inverse first order reliability method to obtain the design penetration depth and section modulus of the steel sheet pile wall in order that the reliability of the wall against failure modes must meet a desired level of safety. Sensitivity analysis is conducted to assess the effect of uncertainties in design parameters on the reliability of cantilever sheet pile walls. The analysis is performed by treating back fill soil properties, depth of the water table from the top of the sheet pile wall, yield strength of steel and section modulus of steel pile as random variables. Two limit states, viz., rotational and flexural failure of sheet pile wall are considered. The results using this approach are used to develop a set of reliability based design charts for different coefficients of variation of friction angle of the backfill (5%, 10% and 15%). System reliability considerations in terms of series and parallel systems are also studied.