Some properties of indium-tin oxide-films

Thin films of indium-tin oxide have been deposited by DC diode sputtering from an indium-tin alloy target in an argon, hydrogen and oxygen atmosphere. Films with sheet resistance of 11 ohms/square and 80% light transmission have been obtained. The effect of cathode composition and gas mixture on sheet resistance and optical transmission properties of the films have been studied.

Mapping of assembled epitopic regions of human chorionic gonadotropin reveals proximity of CTP alpha to the determinant loop beta 93-100

Three overlapping assembled epitopes of beta hCG have been mapped using MAb probes and a single step solid phase radioimmunoassay. These epitopes have been shown to be at receptor binding region comprising of the loop region beta Cys93-Cys100. Importance of disulphide bonds in maintaining integrity of these epitopes is assessed. Two MAbs (INN 58 and INN 22) interact with the beta region as well as the alpha C-terminal peptide, while the other MAb INN 24 interacts with only the beta region. Cross-reactivity pattern with beta hCG and hLH as web as the reported crystal structure of hCG substantiates the epitope identification. The results demonstrate utility of MAbs as probes in investigations on three-dimensional structure of gonadatropins.

Fungal flora of rice field soils

Qualitative and quantitative assessment of the fungal flora of rice field soils yielded 102 species of fungi belonging to 44 genera, when dilution plate, soil plate, root-washing and baiting techniques were employed. The order of efficacy of the methods used was: root-washing > soil plate > dilution plate > baiting. Baiting method, used specifically to isolate aquatic and keratinophilic fungi from soils was studied in detail with reference to the former. Qualitatively, corn leaf bait was the most efficient one while pine pollens and hemp seeds were least efficient. A semi-quantitative method was employed to study the statistically significant differences among the different factors used. Among the keratinophilic baits,viz., human hair, fowl’s feather and wool, wool bait was least efficient. The results of this investigation are discussed.

Factors influencing seasonal and monthly changes in the group size of chital or axis deer in southern India

Chital or axis deer (Axis axis) form fluid groups that change in size temporally and in relation to habitat. Predictions of hypotheses relating animal density, rainfall, habitat structure, and breeding seasonality, to changes in chital group size were assessed simultaneously using multiple regression models of monthly data collected over a 2 yr period in Guindy National Park, in southern India. Over 2,700 detections of chital groups were made during four seasons in three habitats (forest, scrubland and grassland). In scrubland and grassland, chital group size was positively related to animal density, which increased with rainfall. This suggests that in these habitats, chital density increases in relation to food availability, and group sizes increase due to higher encounter rate and fusion of groups. The density of chital in forest was inversely related to rainfall, but positively to the number of fruiting tree species and availability of fallen litter, their forage in this habitat. There was little change in mean group size in the forest, although chital density more than doubled during the dry season and summer. Dispersion of food items or the closed nature of the forest may preclude formation of larger groups. At low densities, group sizes in all three habitats were similar. Group sizes increased with chital density in scrubland and grassland, but more rapidly in the latter—leading to a positive relationship between openness and mean group size at higher densities. It is not clear, however, that this relationship is solely because of the influence of habitat structure. The rutting index (monthly percentage of adult males in hard antler) was positively related to mean group size in forest and scrubland, probably reflecting the increase in group size due to solitary males joining with females during the rut. The fission-fusion system of group formation in chital is thus interactively influenced by several factors. Aspects that need further study, such as interannual variability, are highlighted.

Spatial patterning of the distribution of Ca-2+ in Dictyostelium discoideum

We have shown previously that the Ca2+-specific fluorescent dyes chlortetracycline (CTC) and indo-1/AM can be used to distinguish between prestalk and prespore cells in Dictyostelium discoideum at a very early stage. In the present study, pre- and post-aggregative amoebae of Dictyostelium discoideum were labelled with CTC or indo-1 and their fluorescence monitored after being drawn into a fine glass capillary. The cells rapidly form two zones of Ca2+-CTC or Ca2+-indo-1 fluorescence. Anterior (air side) cells display a high level of fluorescence; the level drops in the middle portion of the capillary and rises again to a lesser extent in the posteriormost cells (oil side). When bounded by air on both sides, the cells display high fluorescence at both ends. When oil is present at both ends of the capillary, there is little fluorescence except for small regions at the ends. These outcomes are evident within a couple of minutes of the start of the experiment and the fluorescence pattern intensifies over the course of time. By using the indicator neutral red, as well as with CTC and indo-1, we show that a band displaying strong fluorescence moves away from the anterior end before stabilizing at the anterior-posterior boundary. We discuss our findings in relation to the role of Ca2+ in cell-type differentiation in Dictyostelium discoideum.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Plant regeneration from protoplasts of Capsicum annuum L cv. California Wonder

Plant regeneration from mesophyll protoplasts of pepper, Capsicum annuum L. cv. California Wonder has been demonstrated via shoot organogenesis, Protoplasts isolated from fully expanded leaves of 3-week-old axenic shoots when cultured in TM medium supplemented with 1 mgl(-1) NAA, 1 mgl(-1) 2, 4-D, 0.5 mgl(-1) BAP (CM 1) resulted in divisions with a frequency ranging from 20-25%. Antioxidant ascorbic acid and polyvinylpyrrolidone (PVP) in the medium and incubation in the dark helped overcome browning of protoplasts. Microcalli and macrocalli were formed in TM medium containing 2 mgl(-1) NAA and 0.5 mgl(-1) BAP (CM II) and MS gelled medium containing 2 mgl(-1) NAA and 0.5 mgl(-1) BAP (CM III), respectively, Regeneration of plantlets was possible via caulogenesis, Microshoots, 2-5 per callus appeared on MS gelled medium enriched with 0.5 mgl(-1) IAA, 2 mgl(-1) GA and 10 mgl(-1) BAP (CM IVc). Rooting of microshoots was obtained on half strength gelled medium containing 1 mgl(-1) NAA and 0.5 mgl(-1) BAP, Protoplasts isolated from cotyledons failed to divide and degenerated eventually.

Comparative sequence analysis and expression in E-coli of the subgroup I-specific antigen VP6 from a G2 serotype human rotavirus IS2

VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.

Mapping of assembled epitopes with microgram quantities of antigen: Identification of an epitope at the receptor binding region of human follicle stimulating hormone

Identification of epitopes by modification studies has been reported by us recently. The method requires milligram quantities of antigen and since several proteins are not available in large quantities they are not amenable for such an investigation. One such protein is human follicle stimulating hormone (hFSH) whose mapping of epitopes is of importance in reproductive biology. Here we report a method that uses microgram quantities of hFSH to map a beta-specific epitope located at the receptor binding region. This identification has also been validated by the chemical modification method using heterologous antigen ovine follicle stimulating hormone (oFSH).

4-Nitro and 4-chloro pyridine-N-oxide complexes of lanthanide perchlorates

Adducts of lanthanide perchlorates with 4-nitro and 4-chloro pyridine-Noxides (4-NPNO and 4-CPNO respectively) have been synthesised for the first time and characterised by analysis, electrolytic conductance, infrared, proton-NMR and electronic spectral data. The complexes are of the compositions Ln2(NPNO)15 (ClO4)6 (Ln = La, Pr, Nd and Gd), Tb(NPNO), (C1O4)6), Ln2(NPNO)13 (C1O4)6) (Ln = Dy, Ho, and Yb); Ln (CPNO)8 (C104)3) (Ln = La, Pr, Nd, Tb, Dy, Ho and Yb) and Ln(CPNO), (C1O4)3) (Ln = Sm and Gd). Conductivity and IR data provide evidence for the non-coordinated nature of the perchlorate groups. IR and NMR spectra suggest coordinationvia the oxygen of the N-oxide group. Electronic spectral shapes of the Nd+3 and Ho+3 complexes are interpreted in terms of eight-and seven-coordinate environments in the case of 4-NPNO complexes and eight-coordination in the case of 4-CPNO complexes. IR data indicate bridged structure in NPNO complexes of lanthanides other than Tb.

Aspects of tautomerism. 8. Solvolysis of some pseudo and normal acid chlorides

Pseudo acid chlorides derived from levulinic acid ando-benzoyl-benzoic acid, solvolyse in aqueous acetone, aqueous dioxane and aqueous dimethylformamide by aS Nl process. Their reaction pattern is distinct from that of typical normal acid chlorides, viz.,p-benzoylbenzoyl chloride and fluorene-9-one-1-carboxylic acid chloride, which solvolyse by aS N2 pathway. No evidence for tautomerism could be obtained either between the normal and pseudo forms of the acid chlorides or the derived ion pairs.

A study of interaction in the lowest singlet and triplet states of H2

The potential energy curves of the ground state and the first excited state of H2 are examined in terms of the electronic force acting on each nucleus. The results reveal the detailed course of events that occur when two hydrogen atoms with parallel and antiparallel electron spins approach one another from a large internuclear separation.

Characterization of a local isolate of Bombyx mori nuclear polyhedrosis virus

Polyhedral bodies of Bombyx mori nuclear polyhedrosis virus, BmNPV (BGL) isolated from infected silkworms around Bangalore were propagated either in the cultured B. mori cell line, BmN or through infection of larvae. Electron microscopic (EM) observations of the polyhedra revealed an average length of 2 mu m and a height of 0.5 mu m. The purified polyhedra derived virions (PDV) showed several bands in sucrose gradient centrifugation, indicating the multiple nucleocapsid nature of BmNPV. Electron microscopic studies of PDV revealed a cylindrical, rod-shaped nucleocapsid with an average length of 300 nm and a diameter of 35 nm. The genomic DNA from the PDV was characterized by extensive restriction analysis and the genome size was estimated to be 132 kb. The restriction pattern of BmNPV (BGL) resembled that of the prototype strain BmNPV-T3. Distinct differences due to polymorphic sites for restriction enzyme HindIII were apparent between BmNPV (BGL) and the virus isolated from a different part of Karnataka (Dharwad area), BmNPV (DHR).