Lacrimal Proline Rich 4 (LPRR4) Protein in the Tear Fluid Is a Potential Biomarker of Dry Eye Syndrome

Dry eye syndrome (DES) is a complex, multifactorial, immune-associated disorder of the tear and ocular surface. DES with a high prevalence world over needs identification of potential biomarkers so as to understand not only the disease mechanism but also to identify drug targets. In this study we looked for differentially expressed proteins in tear samples of DES to arrive at characteristic biomarkers. As part of a prospective case-control study, tear specimen were collected using Schirmer strips from 129 dry eye cases and 73 age matched controls. 2D electrophoresis (2DE) and Differential gel electrophoresis (DIGE) was done to identify differentially expressed proteins. One of the differentially expressed protein in DES is lacrimal proline rich 4 protein (LPRR4). LPRR4 protein expression was quantified by enzyme immune sorbent assay (ELISA). LPRR4 was down regulated significantly in all types of dry eye cases, correlating with the disease severity as measured by clinical investigations. Further characterization of the protein is required to assess its therapeutic potential in DES.

Structural Ordering of Disordered Ligand-Binding Loops of Biotin Protein Ligase into Active Conformations as a Consequence of Dehydration

Mycobacterium tuberculosis (Mtb), a dreaded pathogen, has a unique cell envelope composed of high fatty acid content that plays a crucial role in its pathogenesis. Acetyl Coenzyme A Carboxylase (ACC), an important enzyme that catalyzes the first reaction of fatty acid biosynthesis, is biotinylated by biotin acetyl-CoA carboxylase ligase (BirA). The ligand-binding loops in all known apo BirAs to date are disordered and attain an ordered structure only after undergoing a conformational change upon ligand-binding. Here, we report that dehydration of Mtb-BirA crystals traps both the apo and active conformations in its asymmetric unit, and for the first time provides structural evidence of such transformation. Recombinant Mtb-BirA was crystallized at room temperature, and diffraction data was collected at 295 K as well as at 120 K. Transfer of crystals to paraffin and paratone-N oil (cryoprotectants) prior to flash-freezing induced lattice shrinkage and enhancement in the resolution of the X-ray diffraction data. Intriguingly, the crystal lattice rearrangement due to shrinkage in the dehydrated Mtb-BirA crystals ensued structural order of otherwise flexible ligand-binding loops L4 and L8 in apo BirA. In addition, crystal dehydration resulted in a shift of similar to 3.5 angstrom in the flexible loop L6, a proline-rich loop unique to Mtb complex as well as around the L11 region. The shift in loop L11 in the C-terminal domain on dehydration emulates the action responsible for the complex formation with its protein ligand biotin carboxyl carrier protein (BCCP) domain of ACCA3. This is contrary to the involvement of loop L14 observed in Pyrococcus horikoshii BirA-BCCP complex. Another interesting feature that emerges from this dehydrated structure is that the two subunits A and B, though related by a noncrystallographic twofold symmetry, assemble into an asymmetric dimer representing the ligand-bound and ligand-free states of the protein, respectively. In-depth analyses of the sequence and the structure also provide answers to the reported lower affinities of Mtb-BirA toward ATP and biotin substrates. This dehydrated crystal structure not only provides key leads to the understanding of the structure/function relationships in the protein in the absence of any ligand-bound structure, but also demonstrates the merit of dehydration of crystals as an inimitable technique to have a glance at proteins in action.

Prediction of protein-protein interactions in dengue virus coat proteins guided by low resolution cryoEM structures

Background: Dengue virus along with the other members of the flaviviridae family has reemerged as deadly human pathogens. Understanding the mechanistic details of these infections can be highly rewarding in developing effective antivirals. During maturation of the virus inside the host cell, the coat proteins E and M undergo conformational changes, altering the morphology of the viral coat. However, due to low resolution nature of the available 3-D structures of viral assemblies, the atomic details of these changes are still elusive. Results: In the present analysis, starting from C alpha positions of low resolution cryo electron microscopic structures the residue level details of protein-protein interaction interfaces of dengue virus coat proteins have been predicted. By comparing the preexisting structures of virus in different phases of life cycle, the changes taking place in these predicted protein-protein interaction interfaces were followed as a function of maturation process of the virus. Besides changing the current notion about the presence of only homodimers in the mature viral coat, the present analysis indicated presence of a proline-rich motif at the protein-protein interaction interface of the coat protein. Investigating the conservation status of these seemingly functionally crucial residues across other members of flaviviridae family enabled dissecting common mechanisms used for infections by these viruses. Conclusions: Thus, using computational approach the present analysis has provided better insights into the preexisting low resolution structures of virus assemblies, the findings of which can be made use of in designing effective antivirals against these deadly human pathogens.

Use of S1 nuclease and formamide in combination for the reassociation studies on GC-rich DNA

The optimal parameters in the use of nuclease S1 in DNA reassociation kinetics in the presence of formamide have been determined. The conditions are especially suitable for the study of DNA rich in mole percent GC. A 10-fold dilution of the reassociation samples leading to a decrease in both NaCl and formamide concentrations, consequently resulting in a lowering of Tm by only 1.5°C, and the S1 digestion at temperatures identical to the reassociation assay in order to retain the stability of the duplex, are two important aspects of this system. Under these conditions, the kinetics of reassociation followed the theoretically predicted pattern, while the earlier reported methods have shown lower values.

Geometry Of Proline And Hydroxyproline .1. An Analysis Of X-Ray Crystal-Structure Data

We have carried out an analysis of crystal structure data on prolyl and hydroxyprolyl moieties in small molecules. The flexibility of the pyrrolidine ring due to the pyramidal character of nitrogen has been defined in terms of two projection angles δ1 and δ2. The distribution of these parameters in the crystal structures is found to be consistent with results of the energy calculations carried out on prolyl moieties in our laboratory.

Facile conversion of electron rich benzylic hydrocarbons to carbonyl compounds by peroxydisulphate and copper ions

A convenient method for the conversion of electron rich benzylic hydrocarbons to carbonyl compounds is reported.

Proline ring conformations corresponding to a bistable jump model from 13C spin-lattice relaxation times

A formalism for extracting the conformations of a proline ring based on the bistable jump model of R. E. London [(1978) J. Am. Chem. Soc. 100, 2678-2685] from 13C spin-lattice relaxation times (T1) is given. The method is such that the relaxation data are only partially used to generate the conformations; these conformations are constrained to satisfy the rest of the relaxation data and to yield acceptable ring geometry. An alternate equation for T1 of 13C nuclei to that of London is given. The formalism is illustrated through an example.

Proline-containing β-turns in peptides and proteins: Analysis of structural data on globular proteins

Tetrapeptide sequences of the type Z-Pro-Y-X were obtained from the crystal structure data on 34 globular proteins, and used in an analysis of the positional preferences of the individual amino acid residues in the β-turn conformation. The effect of fixing proline as the second position residue in the tetrapeptide sequence was studied by comparing the data obtained on the positional preferences with the corresponding data obtained by Chou and Fasman using the Z-R-Y-X sequence, where no particular residue was fixed in any of the four positions. While, in general, several amino acid residues having relatively very high or very low preferences for specific positions were found to be common to both the Z-Pro-Y-X and Z-R-Y-X sequences, many significant differences were found between the two sets of data, which are to be attributed to specific interactions arising from the presence of the proline residue.

Alterations in the activities of the enzymes of proline metabolism in Ragi (Eleusine coracana) leaves during water stress

Free proline content in Ragi (Eleusine coracana) leaves increased markedly (6 to 85 fold) as the degree of water stress, created by polyethylene gylcol treatment, was prolonged There was also a marginal increase in soluble proteins in the stressed leaves as compared to that in the controls. Water stress stimulated the activities of ornithine aminotransferase and pyrroline-5-carboxylate reductase, the enzymes of proline biosynthesis and markedly inhibited the enzymes involved in proline degradation viz., proline oxidase and pyrroline-5-carboxylate dehydrogenase. These results suggest that increase in free proline content of Ragi leaves could be due to enhanced activities of the enzymes synthesizing proline but more importantly due to severe inhibition of the enzymes degrading proline. These observations establish for the first time, the pathway of proline metabolism in plants by way of detection of the activities of all the enzymes involved and also highlight the role of these enzymes in proline accumulation during water stress.

Separation of 5-methylcytosine-rich DNA using immobilized antibody

Anti-(5-methylcytosine) antibodies were immobilized on glutaraldehyde-activated Indion 48-R, a polystyrene resin with amino groups. Immobilized antibody was very stable and could be used several times without any apparent change in the initial binding capacity of the antibody-matrix. Fractions of total DNA from various animal and plant sources were retained on this column and could be eluted quantitatively with 1.0 m NaCl. The bound fraction was further characterized for its 5-methylcytosine content by restriction enzyme digestion patterns.

Water stress induced alterations in ornithine aminotransferase of ragi (Eleusine coracana): Protection by proline against heat inactivation and denaturation by urea and guanidinium chloride

Water stress resulted in a specific response leading to a large and significant increase (80-fold) in free proline content of ragi (Eleusine coracana) leaves and seedlings. L-Proline protected ornithine aminotransferase, an enzyme in the pathway for proline biosynthesis, isolated from normal and stressed ragi leaves against heat inactivation and denaturation by urea and guanidinium chloride. The protection of the stressed enzyme by L-proline was much more complete than that of the enzyme isolated from normal leaves. While L-ornithine, one of the substrates, protected the stressed enzyme against inactivation, it enhanced the rate of inactivation of the normal enzyme. α-Ketoglutarate protected both the normal and stressed enzyme against inactivation and denaturation. These results support the suggestion that ornithine aminotransferase has undergone a structural alteration during water stress. In view of the causal relationship between elevated temperature and water stress of plants under natural conditions, the protection afforded by proline against inactivation and denaturation of the enzyme from stressed leaves assumes significance. These results provide an explanation for a possible functional importance of proline accumulation during water stress.

Crystal and molecular structure of allo-4-hydroxy-L-proline dihydrate

allo-4-Hydroxy-L-proline crystallizes from an aqueous solution as the dihydrate. The crystals are orthorhombic, space group P212121, with a=7.08 (2), b=22.13 (3), c= 5"20 (2) A,. The structure was solved by direct methods and refined by block-diagonal least squares. The final R for 733 observed reflexions is 0.054. The molecule exists as a zwitterion with hydroxyl and carboxyl groups cis to the pyrrolidine ring. The latter is puckered at the fl-carbon atom, which deviates by -0.54 A, from the best plane formed by the four remaining atoms. The molecules are held together by a network of hydrogen bonds, the water molecules playing a dominant role in the stability of the structure.

Spatiotemporal Organization of AT- and GC-rich DNA and Their Association With Transition Proteins TP1 and TP2 in Rat Condensing Spermatids

Transition protein 1 (TP1) and TP2 replace histones during midspermiogenesis (stages 12-15) and are finally replaced by protamines. TPs play a predominant role in DNA condensation and chromatin remodeling during mammalian spermiogenesis. TP2 is a zinc metalloprotein with two novel zinc finger modules that condenses DNA in vitro in a GC-preference manner. TP2 also localizes to the nucleolus in transfected HeLa and Cos-7 cells, suggesting a GC-rich preference, even in vivo. We have now studied the localization pattern of TP2 in the rat spermatid nucleus. Colocalization studies using GC-selective DNA-binding dyes chromomycin A3 and 7-amino actinomycin D and an AT-selective dye, 4',6-diamidino-2-phenylindole, indicate that TP2 is preferentially localized to GC-rich sequences. Interestingly, as spermatids mature, TP2 and GC-rich DNA moves toward the nuclear periphery, and in the late stages of spermatid maturation, TP2 is predominantly localized at the nuclear periphery. Another interesting observation is the mutually exclusive localization of GC- and AT-rich DNA in the elongating and elongated spermatids. A combined immunofluorescence experiment with anti-TP2 and anti-TP1 antibodies revealed several foci of overlapping localization, indicating that TP1 and TP2 may have concerted functional roles during chromatin remodeling in mammalian spermiogenesis.

Conformations of Heterochiral and Homochiral Proline-Pseudoproline Segments in Peptides: Context Dependent Cis-Trans Peptide Bond Isomerization

The pseudoproline residue (Psi Pro, L-2,2-dimethyl-1,3-thiazolidine-4-carboxylic acid) has been introduced into heterochiral diproline segments that have been previously shown to facilitate the formation of beta-hairpins, containing central two and three residue turns. NMR studies of the octapeptide Boc-Leu-Phe-Val-(D)Pro-Psi Pro-Leu-Phe-Val-OMe (1), Boc-Leu-Val-Val-(D)Pro-Psi Pro-Leu-Val-Val-OMe (2), and the nonapeptide sequence Boc-Leu-Phe-Val-(D)Pro-Psi Pro-(D)Ala-Leu-Phe-Val-OMe (3) established well-registered beta-hairpin structures in chloroform solution, with the almost exclusive population of the trans conformation for the peptide bond preceding the Psi Pro residue. The beta-hairpin conformation of 1 is confirmed by single crystal X-ray diffraction. Truncation of the strand length in Boc-Val-(D)Pro-Psi Pro-Leu-OMe (4) results in air increase in the population of the cis conformer, with a cis/trans ratio of 3.65. Replacement of Psi Pro in 4 by (L)Pro in 5, results in almost exclusive population of the trans form, resulting in an incipient beta-hairpin conformation, stabilized by two intramolecular hydrogen bonds. Further truncation of the sequence gives an appreciable rise in the population of cis conformers in the tripeptide piv-(D)Pro-Psi Pro-Leu-OMe (6). In the homochiral segment Piv-Pro Psi Pro-Leu-OMe (7) only the cis form is observed with the NMR evidence strongly supporting a type VIa beta-turn conformation, stabilized by a 4 -> 1 hydrogen bond between the Piv (CO) and Leu (3) NH groups. The crystal structure of the analog peptide 7a (Piv-Pro-Psi(H,CH3)Pro-Leu-NHMe) confirms the cis peptide bond geometry for the Pro-Psi(H,CH3)pro peptide bond, resulting in a type VIa beta-turn conformation.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.