Impaired survival of T helper cells in the absence of CD4

Signal transduction in response to ligand recognition by T cell receptors regulates T cell fate within and beyond the thymus. Herein we examine the involvement of the CD4 molecule in the regulation of T helper cell survival. T helper cells that lack CD4 expression are prone to apoptosis and show diminished survival after adoptive transfer to irradiated recipients. The helper lineage in CD4−/− animals shows a higher than normal apparent rate of cell division and is also enriched for cells exhibiting a memory cell phenotype. Thus the data point to a necessary role for CD4 in the regulation of T helper cell survival and homeostasis.

Neuropeptides, by direct interaction with T cells, induce cytokine secretion and break the commitment to a distinct T helper phenotype

Searching for nervous system candidates that could directly induce T cell cytokine secretion, I tested four neuropeptides (NPs): somatostatin, calcitonin gene-related peptide, neuropeptide Y, and substance P. Comparing neuropeptide-driven versus classical antigen-driven cytokine secretion from T helper cells Th0, Th1, and Th2 autoimmune-related T cell populations, I show that the tested NPs, in the absence of any additional factors, directly induce a marked secretion of cytokines [interleukin 2 (IL-2), interferon-γ, IL-4, and IL-10) from T cells. Furthermore, NPs drive distinct Th1 and Th2 populations to a “forbidden” cytokine secretion: secretion of Th2 cytokines from a Th1 T cell line and vice versa. Such a phenomenon cannot be induced by classical antigenic stimulation. My study suggests that the nervous system, through NPs interacting with their specific T cell-expressed receptors, can lead to the secretion of both typical and atypical cytokines, to the breakdown of the commitment to a distinct Th phenotype, and a potentially altered function and destiny of T cells in vivo.

Disruption of the CD4–major histocompatibility complex class II interaction blocks the development of CD4+ T cells in vivo

The experiments presented in this report were designed to specifically examine the role of CD4–major histocompatibility complex (MHC) class II interactions during T cell development in vivo. We have generated transgenic mice expressing class II molecules that cannot interact with CD4 but that are otherwise competent to present peptides to the T cell receptor. MHC class II expression was reconstituted in Aβ gene knock-out mice by injection of a transgenic construct encoding either the wild-type I-Aβb protein or a construct encoding a mutation designed to specifically disrupt binding to the CD4 molecule. We demonstrate that the mutation, EA137 and VA142 in the β2 domain of I-Ab, is sufficient to disrupt CD4–MHC class II interactions in vivo. Furthermore, we show that this interaction is critical for the efficient selection of a complete repertoire of mature CD4+ T helper cells as evidenced by drastically reduced numbers of conventional CD4+ T cells in animals expressing the EA137/VA142 mutant I-Ab and by the failure to positively select the transgenic AND T cell receptor on the mutated I-Ab. These results underscore the importance of the CD4–class II interaction in the development of mature peripheral CD4+ T cells.

A T cell receptor antagonist peptide induces T cells that mediate bystander suppression and prevent autoimmune encephalomyelitis induced with multiple myelin antigens

Experimental autoimmune encephalomyelitis (EAE) induced with myelin proteolipid protein (PLP) residues 139–151 (HSLGKWLGHPDKF) can be prevented by treatment with a T cell receptor (TCR) antagonist peptide (L144/R147) generated by substituting at the two principal TCR contact residues in the encephalitogenic peptide. The TCR antagonist peptide blocks activation of encephalitogenic Th1 helper cells in vitro, but the mechanisms by which the antagonist peptide blocks EAE in vivo are not clear. Immunization with L144/R147 did not inhibit generation of PLP-(139–151)-specific T cells in vivo. Furthermore, preimmunization with L144/R147 protected mice from EAE induced with the encephalitogenic peptides PLP-(178–191) and myelin oligodendrocyte protein (MOG) residues 92–106 and with mouse myelin basic protein (MBP). These data suggest that the L144/R147 peptide does not act as an antagonist in vivo but mediates bystander suppression, probably by the generation of regulatory T cells. To confirm this we generated T cell lines and clones from animals immunized with PLP-(139–151) plus L144/R147. T cells specific for L144/R147 peptide were crossreactive with the native PLP-(139–151) peptide, produced Th2/Th0 cytokines, and suppressed EAE upon adoptive transfer. These studies demonstrate that TCR antagonist peptides may have multiple biological effects in vivo. One of the principal mechanisms by which these peptides inhibit autoimmunity is by the induction of regulatory T cells, leading to bystander suppression of EAE. These results have important implications for the treatment of autoimmune diseases where there are autopathogenic responses to multiple antigens in the target organ.

Trichostatin A reverses skewed expression of CD154, interleukin-10, and interferon-γ gene and protein expression in lupus T cells

In systemic lupus erythematosus (SLE), T helper cells exhibit increased and prolonged expression of cell-surface CD40 ligand (CD154), spontaneously overproduce interleukin-10 (IL-10), but underproduce interferon-gamma (IFN-γ). We tested the hypothesis that the imbalance of these gene products reflects skewed expression of CD154, IL-10, and IFN-γ genes. Here, we demonstrate that the histone deacetylase inhibitor, trichostatin A, significantly down-regulated CD154 and IL-10 and up-regulated IFN-γ gene expression in SLE T cells. This reversal corrected the aberrant expression of these gene products, thereby enhancing IFN-γ production and inhibiting IL-10 and CD154 expression. That trichostatin A can simultaneously reverse the skewed expression of multiple genes implicated in the immunopathogenesis of SLE suggests that this pharmacologic agent may be a candidate for the treatment of this autoimmune disease.

Specific therapy regimes could lead to long-term immunological control of HIV

We use mathematical models to study the relationship between HIV and the immune system during the natural course of infection and in the context of different antiviral treatment regimes. The models suggest that an efficient cytotoxic T lymphocyte (CTL) memory response is required to control the virus. We define CTL memory as long-term persistence of CTL precursors in the absence of antigen. Infection and depletion of CD4+ T helper cells interfere with CTL memory generation, resulting in persistent viral replication and disease progression. We find that antiviral drug therapy during primary infection can enable the development of CTL memory. In chronically infected patients, specific treatment schedules, either including deliberate drug holidays or antigenic boosts of the immune system, can lead to a re-establishment of CTL memory. Whether such treatment regimes would lead to long-term immunologic control deserves investigation under carefully controlled conditions.

An essential role for Bruton's [corrected] tyrosine kinase in the regulation of B-cell apoptosis.

Mutations of the Bruton's tyrosine kinase (btk) gene cause X-linked agammaglobulinemia (XLA) in humans and X-linked immune deficiency (Xid) in mice. To establish the BTK role in B-cell activation we examined the responses of wild-type and Xid B cells to stimulation through surface IgM and CD40, the transducers of thymus independent-type 2 and thymus-dependent activation, respectively. Wild-type BTK was necessary for proliferation induced by soluble anti-IgM (a prototype for thymus independent-type 2 antigen), but not for responses to soluble CD40 ligand (CD40L, the B-cell activating ligand expressed on T-helper cells). In the absence of wild-type BTK, B cells underwent apoptotic death after stimulation with anti-IgM. In the presence of wild-type but not mutated BTK, anti-IgM stimulation reduced apoptotic cell death. In contrast, CD40L increased viability of both wild-type and Xid B cells. Importantly, viability after stimulation correlated with the induced expression of bcl-XL. In fresh ex vivo small resting B cells from wild-type mice there was only barely detectable bcl-XL protein, but there was more in the larger, low-density ("activated") splenic B cells and peritoneal B cells. In vitro Bcl-XL induction following ligation of sIgM-required BTK, was cyclosporin A (CsA)-sensitive and dependent on extracellular Ca2+. CD40-mediated induction of bcl-x required neither wild-type BTK nor extracellular Ca2+ and was insensitive to CsA. These results indicate that BTK lies upstream of bcl-XL in the sIgM but not the CD40 activation pathway. bcl-XL is the first induced protein to be placed downstream of BTK.

Upregulation of class I major histocompatibility complex antigens by interferon gamma is necessary for T-cell-mediated elimination of recombinant adenovirus-infected hepatocytes in vivo.

Recombinant adenoviruses are attractive vehicles for liver-directed gene therapy because of the high efficiency with which they transfer genes to hepatocytes in vivo. First generation recombinant adenoviruses deleted of E1 sequences also express recombinant and early and late viral genes, which lead to development of destructive cellular immune responses. Previous studies indicated that class I major histocompatibility complex (MHC)-restricted cytotoxic T lymphocytes (CTLs) play a major role in eliminating virus-infected cells. The present studies utilize mouse models to evaluate the role of T-helper cells in the primary response to adenovirus-mediated gene transfer to the liver. In vivo ablation of CD4+ cells or interferon gamma (IFN-gamma) was sufficient to prevent the elimination of adenovirus-transduced hepatocytes, despite the induction of a measurable CTL response. Mobilization of an effective TH1 response as measured by in vitro proliferation assays was associated with substantial upregulation of MHC class I expression, an effect that was prevented in IFN-gamma-deficient animals. These results suggest that elimination of virus-infected hepatocytes in a primary exposure to recombinant adenovirus requires both induction of antigen-specific CTLs as well as sensitization of the target cell by TH1-mediated activation of MHC class I expression.

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Copolymer 1 induces T cells of the T helper type 2 that crossreact with myelin basic protein and suppress experimental autoimmune encephalomyelitis

The synthetic amino acid copolymer copolymer 1 (Cop 1) suppresses experimental autoimmune encephalomyelitis (EAE) and is beneficial in multiple sclerosis. To further understand Cop 1 suppressive activity, we studied the cytokine secretion profile of various Cop 1-induced T cell lines and clones. Unlike T cell lines induced by myelin basic protein (MBP), which secreted either T cell helper type 1 (Th1) or both Th1 and Th2 cytokines, the T cell lines/clones induced by Cop 1 showed a progressively polarized development toward the Th2 pathway, until they completely lost the ability to secrete Th1 cytokines. Our findings indicate that the polarization of the Cop 1-induced lines did not result from the immunization vehicle or the in vitro growing conditions, but rather from the tendency of Cop 1 to preferentially induce a Th2 response. The response of all of the Cop 1 specific lines/clones, which were originated in the (SJL/J×BALB/c)F1 hybrids, was restricted to the BALB/c parental haplotype. Even though the Cop 1-induced T cells had not been exposed to the autoantigen MBP, they crossreacted with MBP by secretion of interleukin (IL)-4, IL-6, and IL-10. Administration of these T cells in vivo resulted in suppression of EAE induced by whole mouse spinal cord homogenate, in which several autoantigens may be involved. Secretion of anti-inflammatory cytokines by Cop 1-induced suppressor cells, in response to either Cop 1 or MBP, may explain the therapeutic effect of Cop 1 in EAE and in multiple sclerosis.

T1/ST2 is preferentially expressed on murine Th2 cells, independent of interleukin 4, interleukin 5, and interleukin 10, and important for Th2 effector function

T helper (Th) cells can be categorized according to their cytokine expression. The differential induction of Th cells expressing Th1 and/or Th2 cytokines is key to the regulation of both protective and pathological immune responses. Cytokines are expressed transiently and there is a lack of stably expressed surface molecules, significant for functionally different types of Th cells. Such molecules are of utmost importance for the analysis and selective functional modulation of Th subsets and will provide new therapeutic strategies for the treatment of allergic or autoimmune diseases. To this end, we have identified potential target genes preferentially expressed in Th2 cells, expressing interleukin (IL)-4, IL-5, and/or IL-10, but not interferon-γ. One such gene, T1/ST2, is expressed stably on both Th2 clones and Th2-polarized cells activated in vivo or in vitro. T1/ST2 expression is independent of induction by IL-4, IL-5, or IL-10. T1/ST2 plays a critical role in Th2 effector function. Administration of either a mAb against T1/ST2 or recombinant T1/ST2 fusion protein attenuates eosinophilic inflammation of the airways and suppresses IL-4 and IL-5 production in vivo following adoptive transfer of Th2 cells.

Gene therapy in allergic encephalomyelitis using myelin basic protein-specific T cells engineered to express latent transforming growth factor-β1

A myelin basic protein (MBP)-specific BALB/c T helper 1 (Th1) clone was transduced with cDNA for murine latent transforming growth factor-β1 (TGF-β1) by coculture with fibroblasts producing a genetically engineered retrovirus. When SJL x BALB/c F1 mice, immunized 12–15 days earlier with proteolipid protein in complete Freund’s adjuvant, were injected with 3 × 106 cells from MBP-activated untransduced cloned Th1 cells, the severity of experimental allergic encephalomyelitis (EAE) was slightly increased. In contrast, MBP-activated (but not resting) latent TGF-β1-transduced T cells significantly delayed and ameliorated EAE development. This protective effect was negated by simultaneously injected anti-TGF-β1. The transduced cells secreted 2–4 ng/ml of latent TGF-β1 into their culture medium, whereas control cells secreted barely detectable amounts. mRNA profiles for tumor necrosis factor, lymphotoxin, and interferon-γ were similar before and after transduction; interleukin-4 and -10 were absent. TGF-β1-transduced and antigen-activated BALB/c Th1 clones, specific for hemocyanin or ovalbumin, did not ameliorate EAE. Spinal cords from mice, taken 12 days after receiving TGF-β1-transduced, antigen-activated cells, contained detectable amounts of TGF-β1 cDNA. We conclude that latent TGF-β1-transduced, self-reactive T cell clones may be useful in the therapy of autoimmune diseases.

Interleukin 18 stimulates HIV type 1 in monocytic cells

The cytokine interleukin (IL) 18 (formerly interferon γ-inducing factor) induces the T helper type 1 response. In the present studies, IL-18 increased HIV type 1 (HIV-1) production from 5- to 30-fold in the chronically infected U1 monocytic cell line. Inhibition of tumor necrosis factor (TNF) activity by the addition of TNF-binding protein reduced IL-18-stimulated HIV-1 production by 48%. In the same cultures, IL-18-induced IL-8 was inhibited by 96%. Also, a neutralizing anti-IL-6 mAb reduced IL-18-induced HIV-1 by 63%. Stimulation of U1 cells with IL-18 resulted in increased production of IL-6, and exogenous IL-6 added to U1 cells increased HIV-1 production 4-fold over control. A specific inhibitor of the p38 mitogen-activated protein kinase reduced IL-18-induced HIV-1 by 73%, and a 50% inhibition was observed at 0.05 μM. In the same cultures, IL-8 was inhibited by 87%. By gel-shift and supershift analyses, increased binding activity of the transcription factor NF-κB was measured in nuclear extracts from U1 cells 1 h after exposure to IL-18. These results demonstrate induction of HIV-1 by IL-18 in a monocyte target associated with an intermediate role for TNF and IL-6, activation of p38 mitogen-activated protein kinase, and nuclear translocation of NF-κB.

CXCR4 and CD4 mediate a rapid CD95-independent cell death in CD4+ T cells

AIDS is characterized by a progressive decrease of CD4+ helper T lymphocytes. Destruction of these cells may involve programmed cell death, apoptosis. It has previously been reported that apoptosis can be induced even in noninfected cells by HIV-1 gp120 and anti-gp120 antibodies. HIV-1 gp120 binds to T cells via CD4 and the chemokine coreceptor CXCR4 (fusin/LESTR). Therefore, we investigated whether CD4 and CXCR4 mediate gp120-induced apoptosis. We used human peripheral blood lymphocytes, malignant T cells, and CD4/CXCR4 transfectants, and found cell death induced by both cell surface receptors, CD4 and CXCR4. The induced cell death was rapid, independent of known caspases, and lacking oligonucleosomal DNA fragmentation. In addition, the death signals were not propagated via p56lck and Giα. However, the cells showed chromatin condensation, morphological shrinkage, membrane inversion, and reduced mitochondrial transmembrane potential indicative of apoptosis. Significantly, apoptosis was exclusively observed in CD4+ but not in CD8+ T cells, and apoptosis triggered via CXCR4 was inhibited by stromal cell-derived factor-1, the natural CXCR4 ligand. Thus, this mechanism of apoptosis might contribute to T cell depletion in AIDS and might have major implications for therapeutic intervention.