Evaluation of Quantitative RT-PCR Using Nonamplified and Amplified RNA

Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) is a standard assay in molecular medicine for gene expression analysis. Samples from incisional/needle biopsies, laser-microdissected tumor cells and other biologic sources, normally available in clinical cancer studies, generate very small amounts of RNA that are restrictive for expression analysis. As a consequence, an RNA amplification procedure is required to assess the gene expression levels of such sample types. The reproducibility and accuracy of relative gene expression data produced by sensitive methodology as qRT-PCR when cDNA converted from amplified (A) RNA is used as template has not yet been properly addressed. In this study, to properly evaluate this issue, we performed 1 round of linear RNA amplification in 2 breast cell lines (C5.2 and HB4a) and assessed the relative expression of 34 genes using cDNA converted from both nonamplified (NA) and A RNA. Relative gene expression was obtained from beta actin or glyceraldehyde 3-phosphate dehydrogenase normalized data using different dilutions of cDNA, wherein the variability and fold-change differences in the expression of the 2 methods were compared. Our data showed that 1 round of linear RNA amplification, even with suboptimal-quality RNA, is appropriate to generate reproducible and high-fidelity qRT-PCR relative expression data that have similar confidence levels as those from NA samples. The use of cDNA that is converted from both A and NA RNA in a single qRT-PCR experiment clearly creates bias in relative gene expression data.

Detection of hantaviruses in Brazilian rodents by SYBR-Green-based real-time RT-PCR

Current knowledge of the pathogenic hantavirus indicates that wild rodents are its primary natural reservoir. Specific primers to detect the presence of viral genomes were developed using an SYBR-Green-based real-time RT-PCR protocol. One hundred sixty-four rodents native to the Atlantic Forest biome were captured in So Paulo State, Brazil, and their tissues were tested. The presence of hantavirus RNA was detected in sixteen rodents: three specimens of Akodon montensis, three of Akodon cursor, two of Necromys lasiurus, one of Juliomys sp., one of Thaptomys nigrita, five of Oligoryzomys nigripes, and one of Oryzomys sp. This SYBR Green real-time RT-PCR method for detection of hantavirus may be useful for surveying hantaviruses in Brazil.

Effect of creatine supplementation on housekeeping genes in human skeletal muscle using real-time RT-PCR

The present study examined the validity and reliability of measuring the expression of various genes in human skeletal muscle using quantitative real-time RT-PCR on a GeneAmp 5700 sequence detection system with SYBR Green 1 chemistry. In addition, the validity of using some of these genes as endogenous controls (i.e., housekeeping genes) when human skeletal muscle was exposed to elevated total creatine levels and exercise was also examined. For all except 28S, linear relationships between the logarithm of the starting RNA concentrations and the cycle threshold (C_T) values were established for ß-actin, ß2-microglobulin (ß₂M), cyclophilin (CYC), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). We found a linear response between C_T values and the logarithm of a given amount of starting cDNA for all the genes tested. The overall intra-assay coefficient of variance for these genes was 1.3% and 21% for raw C_T values and the linear value of 2^-C_T, respectively. Interassay variability was 2.3% for raw C_T values and 34% for the linear value of 2^-C_T. We also examined the expression of various housekeeping genes in human skeletal muscle at days 0, 1, and 5 following oral supplementation with either creatine or a placebo employing a double-blind crossover study design. Treatments were separated by a 5-wk washout period. Immediately following each muscle sampling, subjects performed two 30-s all-out bouts on a cycle ergometer. Creatine supplementation increased (P < 0.05) muscle total creatine content above placebo levels; however, there were no changes (P > 0.05) in C_T values across the supplementation periods for any of the genes. Nevertheless, 95% confidence intervals showed that GAPDH was variable, whereas ß-actin, ß₂M, and CYC were the least varying genes. Normalization of the data to these housekeeping genes revealed variable behavior for ß₂M with more stable expressions for both ß-actin and CYC. We conclude that, using real-time RT-PCR, ß-actin or CYC may be used as housekeeping genes to study gene expression in human muscle in experiments employing short-term creatine supplementation combined with high-intensity exercise.

Real time RT-PCR analysis of housekeeping genes in human skeletal muscle following acute exercise

Studies examining gene expression with RT-PCR typically normalize their mRNA data to a constitutively expressed housekeeping gene. The validity of a particular housekeeping gene must be determined for each experimental intervention. We examined the expression of various housekeeping genes following an acute bout of endurance (END) or resistance (RES) exercise. Twenty-four healthy subjects performed either a interval-type cycle ergometry workout to exhaustion (~75 min; END) or 300 single-leg eccentric contractions (RES). Muscle biopsies were taken before exercise and 3 h and 48 h following exercise. Real-time RT-PCR was performed on ß-actin, cyclophilin (CYC), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and ß2-microglobulin (ß2M). In a second study, 10 healthy subjects performed 90 min of cycle ergometry at ~65% of O2 max, and we examined a fifth housekeeping gene, 28S rRNA, and reexamined ß2M, from muscle biopsy samples taken immediately postexercise. We showed that CYC increased 48 h following both END and RES exercise (3- and 5-fold, respectively; P < 0.01), and 28S rRNA increased immediately following END exercise (2-fold; P = 0.02). ß-Actin trended toward an increase following END exercise (1.85-fold collapsed across time; P = 0.13), and GAPDH trended toward a small yet robust increase at 3 h following RES exercise (1.4-fold; P = 0.067). In contrast, ß2M was not altered at any time point postexercise. We conclude that ß2M and ß-actin are the most stably expressed housekeeping genes in skeletal muscle following RES exercise, whereas ß2M and GAPDH are the most stably expressed following END exercise.

Integrated RNA extraction and RT-PCR for semi-quantitative gene expression studies on a microfluidic device

This paper describes the development of a microfluidic methodology, using RNA extraction and reverse transcription PCR, for investigating expression levels of cytochrome P450 genes. Cytochrome P450 enzymes are involved in the metabolism of xenobiotics, including many commonly prescribed drugs, therefore information on their expression is useful in both pharmaceutical and clinical settings. RNA extraction, from rat liver tissue or primary rat hepatocytes, was performed using a silica-based solid-phase extraction technique. Following elution of the purified RNA, amplification of target sequences for the housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and the cytochrome P450 gene CYP1A2, was carried out using a one-step reverse transcription PCR. Once the microfluidic methodology had been optimized, analysis of control and 3-methylcholanthrene-induced primary rat hepatocytes were used to evaluate the system. As expected, GAPDH was consistently expressed, whereas CYP1A2 levels were found to be raised in the drug-treated samples. The proposed system offers an initial platform for development of both rapid throughput analyzers for pharmaceutical drug screening and point-of-care diagnostic tests to aid provision of drug regimens, which can be tailor-made to the individual patient.

Caracterização parcial de um fragmento e detecção por RT-PCR de Rice Stripe Necrosis Virus

O enrolamento do arroz é uma doença viral emergente no Brasil causada pelo Rice stripe necrosis virus (RSNV) que é transmitido pelo protozoário Polymyxa graminis. RSNV é um membro do gênero Benyvirus com genoma dividido em 4 RNAs de fita simples no sentido positivo (ssRNA +). Em função da falta de conhecimento sobre a seqüência de nucleotídeos do seu genoma, a detecção de RSNV através de métodos moleculares não é utilizada. O objetivo deste trabalho foi identificar seqüências do genoma de RSNV que possibilitassem sua detecção em plantas de arroz através da técnica de transcrição reversa seguida da reação em cadeia da polimerase (RT-PCR). As seqüências do genoma foram identificadas a partir de clones de uma biblioteca de cDNAs obtidos de uma amostra do vírus parcialmente purificado. Os clones que hibridizaram com sondas sintetizadas a partir de RNA de plantas infectadas com RSNV foram seqüenciados e comparados às seqüências do GenBank. Um fragmento de 957 nt da extremidade 3’ da fita de um dos 4 RNAs genômicos de RSNV foi obtido. A análise da seqüência nucleotídeos desse fragmento não revelou qualquer similaridade com seqüências conhecidas, tampouco indicou uma possível função. Um par de oligonucleotídeos iniciadores foi desenhado a partir de um clone que potencialmente contém uma seqüência de RSNV. A especificidade e a sensibilidade da RT-PCR utilizando esse par de oligonucleotídeos iniciadores, bem como sua eficiência na detecção do vírus em diferentes partes da planta de arroz, foram avaliadas. Os resultados indicam que a RT-PCR é específica para RSNV e pode detectar o vírus em tecido oriundo das raízes, do colo e de folhas com distorção. Comparada ao diagnóstico da doença através da observação de sintomas e de estruturas do vetor, a RT-PCR é uma ferramenta confiável para a diagnose do enrolamento do arroz.

Infectious bronchitis virus: detection and vaccine Strain differentiation by semi-nested RT-PCR

A semi-nested reverse transcription-polymerase chain reaction (Semi-N-RT-PCR) was developed and used to detect the S glycoprotein gene of infectious bronchitis virus (IBV) strains and to discriminate H120 vaccine strain from other strains. Viral RNA was extracted from the allantoic fluid of chicken embryos and from tissues of chickens experimentally infected with different strains of IBV. Amplification and identification of the viral RNA was performed using two sets of primers complementary to a region of the S glycoprotein gene in the Semi-N-RT-PCR assay. The pair of primers used in the first PCR consisted of universal oligonucleotides flanking a more variable region of S1-S2 gene. The second primer pair was used in the Semi-N-RT-PCR and was comprised of one of the primers from the first universal pair together with either another universal internal oligolucleotide or a oligonucleotide sequence specific for the H120 strain of IBV. The universal primers detected all reference IBV strains and field isolates tested herein. The Semi-N-RT-PCR had high sensitivity and specificity, and was able to differentiate the H120 vaccine strain from other reference IBV strains; including M41 strain. All tissue samples collected from chickens experimentally infected with H120 or M41 strains were positive in the semi-nested RT-PCR using universal primers, while only the H120-infected tissue samples were amplified by the set of primers containing the H120-oligonucleotide. In conclusion, the ability of Semi-N-RT-PCR to detect distinct IBV strains and preliminarily discriminate the vaccine strain (H120) closes a diagnostic gap and offers the opportunity to use comprehensive PCR procedures for the IBV diagnosis.

Further characterization of two sequiviruses infecting lettuce and development of specific RT-PCR primers

Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Bidens mosaic virus: detecção via RT-PCR e identificação de Galinsoga parviflora como um novo hospedeiro natural do vírus

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Assessment of cytokine values in serum by RT-PCR in HIV-1 infected individuals with and without highly active anti-retroviral therapy (HAART)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

The heminested RT-PCR for the study of rabies virus pathogenesis

The aim of the present trial was to evaluate the heminested RT-PCR for the study of rabies virus distribution in mice inoculated experimentally. Inoculation was by the intramuscular route in 150 mice, using the dog street rabies virus. Groups of five animals were killed at different times. Fragments of different organs were collected and the material was tested by Fluorescent Antibody Test (FAT) and heminested RT-PCR (hn RT-PCR). Positive results were obtained beginning on the 10th day after inoculation in the brain, spinal cord, salivary gland, limbs, lungs, liver, spleen, urinary bladder, tongue and right kidney. Hn RT-PCR was shown to be more efficient for the study of rabies virus distribution in different tissues and organs. (C) 2004 Elsevier B.V.. All rights reserved.

Comparison between RT-PCR and the mouse inoculation test for detection of rabies virus in samples kept for long periods under different conditions

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Quantification of bovine cytokine gene expression using real-time RT-PCR methodology

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)