The complete genome sequence of Chromobacterium violaceum reveals remarkable and exploitable bacterial adaptability

Chromobacterium violaceum is one of millions of species of free-living microorganisms that populate the soil and water in the extant areas of tropical biodiversity around the world. Its complete genome sequence reveals (i) extensive alternative pathways for energy generation, (ii) ≈500 ORFs for transport-related proteins, (iii) complex and extensive systems for stress adaptation and motility, and (iv) wide-spread utilization of quorum sensing for control of inducible systems, all of which underpin the versatility and adaptability of the organism. The genome also contains extensive but incomplete arrays of ORFs coding for proteins associated with mammalian pathogenicity, possibly involved in the occasional but often fatal cases of human C. violaceum infection. There is, in addition, a series of previously unknown but important enzymes and secondary metabolites including paraquat-inducible proteins, drug and heavy-metal-resistance proteins, multiple chitinases, and proteins for the detoxification of xenobiotics that may have biotechnological applications.

Complete genomic sequence of a Rubus yellow net virus isolate and detection of genome-wide pararetrovirus-derived small RNAs

Rubus yellow net virus (RYNV) was cloned and sequenced from a red raspberry (Rubus idaeus L.) plant exhibiting symptoms of mosaic and mottling in the leaves. Its genomic sequence indicates that it is a distinct member of the genus Badnavirus, with 7932. bp and seven ORFs, the first three corresponding in size and location to the ORFs found in the type member Commelina yellow mottle virus. Bioinformatic analysis of the genomic sequence detected several features including nucleic acid binding motifs, multiple zinc finger-like sequences and domains associated with cellular signaling. Subsequent sequencing of the small RNAs (sRNAs) from RYNV-infected R. idaeus leaf tissue was used to determine any RYNV sequences targeted by RNA silencing and identified abundant virus-derived small RNAs (vsRNAs). The majority of the vsRNAs were 22-nt in length. We observed a highly uneven genome-wide distribution of vsRNAs with strong clustering to small defined regions distributed over both strands of the RYNV genome. Together, our data show that sequences of the aphid-transmitted pararetrovirus RYNV are targeted in red raspberry by the interfering RNA pathway, a predominant antiviral defense mechanism in plants. © 2013.

Nucleotide sequence of coat protein gene for GPV isolate of barley yellow dwarf virus and construction of expression plasmid for plant

GPV is a Chinese serotype isolate of barley yellow dwarf virus (BYDV) that has no reaction with antiserum of MAV, PAV, SGV, RPV and RMV The sequence of the coat protein (CP) of GPV isolate of BYDV was identified and its amino acid sequence was deduced. The coding region for the putative GPV CP is 603 bases nucleotides and encodes a Mr 22 218 (22 ku) protein. The same as MAV, PAV and RPV, GPV contained a second ORF within the coat protein coding region. This protein of 17 024 Mr (17 ku) is thought to correspond to the Virion protein genome linked (Vpg). Sequence comparisons of the CP coding region between the GPV isolate of BYDV and other isolates of BYDV have been done. The nucleotide and amino acid sequence homology of GPV has a greater identity to the sequence of RPV than those of PAV and MAV. The GPV CP sequence stored 83.7% of nucleotide similarity and 77.5% of deduced amino acid similarity, whereas that of the PAV and MAV shared 56.9%, 53.2% and 44.1%, 43.8% respectively. According to BYDV-GPV CP sequence, two primers were designed. The cDNA of CP was produced by RT-PCR. Full-length cDNA of CP was inserted into plasmid to construct expression plasmids named pPPI1, pPPI2 and pPPI5 based on different promoters. The recombinant plasmids were identified by using α-32P-dATP labelled CP probe, α-32P-ATP labelled GPV RNA probe and sequencing to confirm real GPV CP gene cDNA in plasmids.

The complete genome sequence of Escherichia coli EC958: a high quality reference sequence for the globally disseminated multidrug resistant E. coli O25b:H4-ST131 clone

Escherichia coli ST131 is now recognised as a leading contributor to urinary tract and bloodstream infections in both community and clinical settings. Here we present the complete, annotated genome of E. coli EC958, which was isolated from the urine of a patient presenting with a urinary tract infection in the Northwest region of England and represents the most well characterised ST131 strain. Sequencing was carried out using the Pacific Biosciences platform, which provided sufficient depth and read-length to produce a complete genome without the need for other technologies. The discovery of spurious contigs within the assembly that correspond to site-specific inversions in the tail fibre regions of prophages demonstrates the potential for this technology to reveal dynamic evolutionary mechanisms. E. coli EC958 belongs to the major subgroup of ST131 strains that produce the CTX-M-15 extended spectrum β-lactamase, are fluoroquinolone resistant and encode the fimH30 type 1 fimbrial adhesin. This subgroup includes the Indian strain NA114 and the North American strain JJ1886. A comparison of the genomes of EC958, JJ1886 and NA114 revealed that differences in the arrangement of genomic islands, prophages and other repetitive elements in the NA114 genome are not biologically relevant and are due to misassembly. The availability of a high quality uropathogenic E. coli ST131 genome provides a reference for understanding this multidrug resistant pathogen and will facilitate novel functional, comparative and clinical studies of the E. coli ST131 clonal lineage.

Mixture models of nucleotide sequence evolution that account for heterogeneity in the substitution process across sites and across lineages

Molecular phylogenetic studies of homologous sequences of nucleotides often assume that the underlying evolutionary process was globally stationary, reversible, and homogeneous (SRH), and that a model of evolution with one or more site-specific and time-reversible rate matrices (e.g., the GTR rate matrix) is enough to accurately model the evolution of data over the whole tree. However, an increasing body of data suggests that evolution under these conditions is an exception, rather than the norm. To address this issue, several non-SRH models of molecular evolution have been proposed, but they either ignore heterogeneity in the substitution process across sites (HAS) or assume it can be modeled accurately using the distribution. As an alternative to these models of evolution, we introduce a family of mixture models that approximate HAS without the assumption of an underlying predefined statistical distribution. This family of mixture models is combined with non-SRH models of evolution that account for heterogeneity in the substitution process across lineages (HAL). We also present two algorithms for searching model space and identifying an optimal model of evolution that is less likely to over- or underparameterize the data. The performance of the two new algorithms was evaluated using alignments of nucleotides with 10 000 sites simulated under complex non-SRH conditions on a 25-tipped tree. The algorithms were found to be very successful, identifying the correct HAL model with a 75% success rate (the average success rate for assigning rate matrices to the tree's 48 edges was 99.25%) and, for the correct HAL model, identifying the correct HAS model with a 98% success rate. Finally, parameter estimates obtained under the correct HAL-HAS model were found to be accurate and precise. The merits of our new algorithms were illustrated with an analysis of 42 337 second codon sites extracted from a concatenation of 106 alignments of orthologous genes encoded by the nuclear genomes of Saccharomyces cerevisiae, S. paradoxus, S. mikatae, S. kudriavzevii, S. castellii, S. kluyveri, S. bayanus, and Candida albicans. Our results show that second codon sites in the ancestral genome of these species contained 49.1% invariable sites, 39.6% variable sites belonging to one rate category (V1), and 11.3% variable sites belonging to a second rate category (V2). The ancestral nucleotide content was found to differ markedly across these three sets of sites, and the evolutionary processes operating at the variable sites were found to be non-SRH and best modeled by a combination of eight edge-specific rate matrices (four for V1 and four for V2). The number of substitutions per site at the variable sites also differed markedly, with sites belonging to V1 evolving slower than those belonging to V2 along the lineages separating the seven species of Saccharomyces. Finally, sites belonging to V1 appeared to have ceased evolving along the lineages separating S. cerevisiae, S. paradoxus, S. mikatae, S. kudriavzevii, and S. bayanus, implying that they might have become so selectively constrained that they could be considered invariable sites in these species.

Nucleotide sequence of initiator tRNA from Mycobacterium smegmatis

Abstract is not available.

First complete genome sequence of a capsicum chlorosis tospovirus isolate from Australia with an unusually large S RNA intergenic region

The first complete genome sequence of capsicum chlorosis virus (CaCV) from Australia was determined using a combination of Illumina HiSeq RNA and Sanger sequencing technologies. Australian CaCV had a tripartite genome structure like other CaCV isolates. The large (L) RNA was 8913 nucleotides (nt) in length and contained a single open reading frame (ORF) of 8634 nt encoding a predicted RNA-dependent RNA polymerase (RdRp) in the viral-complementary (vc) sense. The medium (M) and small (S) RNA segments were 4846 and 3944 nt in length, respectively, each containing two non-overlapping ORFs in ambisense orientation, separated by intergenic regions (IGR). The M segment contained ORFs encoding the predicted non-structural movement protein (NSm; 927 nt) and precursor of glycoproteins (GP; 3366 nt) in the viral sense (v) and vc strand, respectively, separated by a 449-nt IGR. The S segment coded for the predicted nucleocapsid (N) protein (828 nt) and non-structural suppressor of silencing protein (NSs; 1320 nt) in the vc and v strand, respectively. The S RNA contained an IGR of 1663 nt, being the largest IGR of all CaCV isolates sequenced so far. Comparison of the Australian CaCV genome with complete CaCV genome sequences from other geographic regions showed highest sequence identity with a Taiwanese isolate. Genome sequence comparisons and phylogeny of all available CaCV isolates provided evidence for at least two highly diverged groups of CaCV isolates that may warrant re-classification of AIT-Thailand and CP-China isolates as unique tospoviruses, separate from CaCV.

Complete genome sequence and intracellular protein localization of Datura yellow vein nucleorhabdovirus

A limited number of plant rhabdovirus genomes have been fully sequenced, making taxonomic classification, evolutionary analysis and molecular characterization of this virus group difficult. We have for the first time determined the complete genome sequence of 13,188 nucleotides of Datura yellow vein nucleorhabdovirus (DYVV). DYVV genome organization resembles that of its closest relative, Sonchus yellow net virus (SYNV), with six ORFs in antigenomic orientation, separated by highly conserved intergenic regions and flanked by complementary 3′ leader and 5′ trailer sequences. As is typical for nucleorhabdoviruses, all viral proteins, except the glycoprotein, which is targeted to the endoplasmic reticulum, are localized to the nucleus. Nucleocapsid (N) protein, matrix (M) protein and polymerase, as components of nuclear viroplasms during replication, have predicted strong canonical nuclear localization signals, and N and M proteins exclusively localize to the nucleus when transiently expressed as GFP fusions. As in all nucleorhabdoviruses studied so far, N and phosphoprotein P interact when co-expressed, significantly increasing P nuclear localization in the presence of N protein. This research adds to the list of complete genomes of plant-infecting rhabdoviruses, provides molecular tools for further characterization and supports classification of DYVV as a nucleorhabdovirus closely related to but with some distinct differences from SYNV.

Nucleotide sequence of the 3' terminal region of belladonna mottle virus-Iowa (renamed Physalis mottle virus) RNA and an analysis of the relationships of tymoviral coat proteins

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Cucumber chloroplast trnL(CAA) gene: nucleotide sequence and in vivo expression analysis in etiolated cucumber seedlings treated with benzyladenine and light.

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.

Cucumber chloroplast trnL(CAA) gene: nucleotide sequence and in vivo expression analysis in etiolated cucumber seedlings treated with benzyladenine and light

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA- treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had not detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These date indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.

Azospirillum lipoferum tRNAs: Fractionation and identification of tRNA species and the nucleotide sequence of tRNA(Asn) (QUU)

Transfer RNAs of Azospirillum lipoferum were separated by two- dimensional gel electrophoresis and identified by aminoacylation. Thirty-six tRNA spots were resolved by this technique and twenty-six tRNA species have been identified. There are five tRNAs for Leu, four for Val, three for Pro, two each for Arg, Ile, Lys and Tyr, and one each for Ala, Asp, His, Phe, Ser and Thr. The tRNA(Asn) (QUU) was purified and its nucleotide sequence was determined. The A. lipoferum tRNA(Asn) (QUU) is 92% similar to B. subtilis tRNA(Asn) gene and two hypermodified nucleosides, queuosine (Q) and N-(9-beta-D Ribofuranosylpurine-6-YL) carbamoyl)-threonine (t(6)A) are present in this tRNA.

Complete genome sequence of Colocasia bobone disease-associated virus, a putative cytorhabdovirus infecting taro

We report the first genome sequence of a Colocasia bobone disease-associated virus (CBDaV) derived from bobone-affected taro [Colocasia esculenta L. Schott] from Solomon Islands. The negative-strand RNA genome is 12,193 nt long, with six major open reading frames (ORFs) with the arrangement 3′-N-P-P3-M-G-L-5′. Typical of all rhabdoviruses, the 3′ leader and 5′ trailer sequences show complementarity to each other. Phylogenetic analysis indicated that CBDaV is a member of the genus Cytorhabdovirus, supporting previous reports of virus particles within the cytoplasm of bobone-infected taro cells. The availability of the CBDaV genome sequence now makes it possible to assess the role of this virus in bobone, and possibly alomae disease of taro and confirm that this sequence is that of Colocasia bobone disease virus (CBDV).

Nucleotide-sequence of 5S RNA from mycobacterium-smegmatis

32P labelled 5S RNA isolated fromMycobacterium smegmatis was digested withT 1 and pancreatic ribonucleases separately and fingerprinted by two dimensional high voltage electrophoresis on thin-layer DEAE-cellulose plates. The radioactive spots were sequenced and their molar yields were determined. The chain length of the 5S RNA was found to be 120. It showed resemblances to both prokaryotic and eukaryotic 5S RNAs.