406 resultados para CHLOROPLAST
Error, Bias, and Long-Branch Attraction in Data for Two Chloroplast Photosystem Genes in Seed Plants
Resumo:
Sequences of two chloroplast photosystem genes, psaA and psbB, together comprising about 3,500 bp, were obtained for all five major groups of extant seed plants and several outgroups among other vascular plants. Strongly supported, but significantly conflicting, phylogenetic signals were obtained in parsimony analyses from partitions of the data into first and second codon positions versus third positions. In the former, both genes agreed on a monophyletic gymnosperms, with Gnetales closely related to certain conifers. In the latter, Gnetales are inferred to be the sister group of all other seed plants, with gymnosperms paraphyletic. None of the data supported the modern ‘‘anthophyte hypothesis,’’ which places Gnetales as the sister group of flowering plants. A series of simulation studies were undertaken to examine the error rate for parsimony inference. Three kinds of errors were examined: random error, systematic bias (both properties of finite data sets), and statistical inconsistency owing to long-branch attraction (an asymptotic property). Parsimony reconstructions were extremely biased for third-position data for psbB. Regardless of the true underlying tree, a tree in which Gnetales are sister to all other seed plants was likely to be reconstructed for these data. None of the combinations of genes or partitions permits the anthophyte tree to be reconstructed with high probability. Simulations of progressively larger data sets indicate the existence of long-branch attraction (statistical inconsistency) for third-position psbB data if either the anthophyte tree or the gymnosperm tree is correct. This is also true for the anthophyte tree using either psaA third positions or psbB first and second positions. A factor contributing to bias and inconsistency is extremely short branches at the base of the seed plant radiation, coupled with extremely high rates in Gnetales and nonseed plant outgroups. M. J. Sanderson,* M. F. Wojciechowski,*† J.-M. Hu,* T. Sher Khan,* and S. G. Brady
Resumo:
Infection of plant cells by potyviruses induces the formation of cytoplasmic inclusions ranging in size from 200 to 1000 nm. To determine if the ability to form these ordered, insoluble structures is intrinsic to the potyviral cytoplasmic inclusion protein, we have expressed the cytoplasmic inclusion protein from Potato virus Y in tobacco under the control of the chrysanthemum ribulose-1,5-bisphosphate carboxylase small subunit promoter, a highly active, green tissue promoter. No cytoplasmic inclusions were observed in the leaves of transgenic tobacco using transmission electron microscopy, despite being able to clearly visualize these inclusions in Potato virus Y infected tobacco leaves under the same conditions. However, we did observe a wide range of tissue and sub-cellular abnormalities associated with the expression of the Potato virus Y cytoplasmic inclusion protein. These changes included the disruption of normal cell morphology and organization in leaves, mitochondrial and chloroplast internal reorganization, and the formation of atypical lipid accumulations. Despite these significant structural changes, however, transgenic tobacco plants were viable and the results are discussed in the context of potyviral cytoplasmic inclusion protein function.
Resumo:
2,3-Dihydroxybenzoate-2,3-oxygenase is mainly localized in the soluble and the chloroplast fractions of Tecoma leaves. It is associated with the lamellar structure of the chloroplast fraction. The chloroplast enzyme has properties similar to those of the soluble enzyme, but it has a longer half-life and is more stable to dialysis than the soluble enzyme. It is inhibited by sulfhydryl reagents and the inhibition is reversed by the addition of reduced glutathione. The chloroplast enzyme is insensitive to iron-chelating agents. The enzyme loses activity on dialysis against copper-chelating agents and the activity is completely recovered on the addition of copper; addition of iron does not restore the activity. Polyphenol oxidase is probably present only in the active form in the Tecoma chloroplast but it is not involved in the intradiol cleavage of 2,3-dihydroxybenzoic acid.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA- treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had not detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These date indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.
Resumo:
The relative amounts of chloroplast tRNAs(Leu), tRNA(Glu), tRNA(Phe), tRNAs(Thr), and tRNA(Tyr) and of chloroplastic and cytoplasmic aminoacyl-tRNA synthetases were compared in green leaves, yellowing senescing leaves, and N(6)-benzyladenine-treated senescing leaves from bean (Phaseolus vulgaris, var Contender). Aminoacylation of the tRNAs using Escherichia coli aminoacyl-tRNA synthetases indicated that in senescing leaves the relative amount of chloroplast tRNA(Phe) was significantly lower than in green leaves. Senescing leaves treated with N(6)-benzyladenine contained higher levels of this tRNA than untreated senescing leaves. No significant change in the relative amounts of chloroplast tRNAs(Leu), tRNAs(Thr), and tRNA(Tyr) was detected in green, yellow senescing, or N(6)-benzyladine-treated senescing leaves. Relative levels of chloroplast tRNAs were also estimated by hybridization of tRNAs to DNA blots of gene specific probes. These experiments confirmed the results obtained by aminoacylation and revealed in addition that the relative level of chloroplast tRNA(Glu) is higher in senescing leaves than in green leaves. Transcription run-on assays indicated that these changes in tRNA levels are likely to be due to a differential rate of degradation rather than to a differential rate of transcription of the tRNA genes. Chloroplastic and cytoplasmic leucyl-, phenylalanyl-, and tyrosyl-tRNA synthetase activities were greatly reduced in senescing leaves as compared to green leaves, whereas N(6)-benzyladenine-treated senescing leaves contained higher enzyme activities than untreated senescing leaves. These results suggest that during senescence, as well as during senescence-retardation by cytokinins, changes in enzyme activities, such as aminoacyl-tRNA synthetases, rather than reduced levels of tRNAs, affect the translational capacity of chloroplasts.
Resumo:
An enzyme system which converts anthranilic acid to catechol was detected in the leaves of Tecoma stans, and its properties studied. The system is present exclusively in the chloroplast fraction of the leaves. The optimum pH of the reaction is 5·2 and maximum activity was obtained with citrate-phosphate buffer. There was good stoichiometry between the amounts of anthranilic acid disappeared and the amounts of catechol and ammonia formed. The enzyme system showed an absolute requirement for oxygen and evidence was obtained for the probable participation of NADPH and FAD in the hydroxylation step. The optimum concentration of anthranilic acid was 10−4 M; at higher concentrations the reaction was inhibited to a considerable extent. Cyanide, pyrophosphate, and EDTA also caused inhibition indicating a requirement for metal ions.