671 resultados para bioscience
Resumo:
Aspartate transcarbamylase (EC 2.1.3.2) was purified to homogeniety from germinated mung bean seedlings by treatment with carbamyl phosphate. The purified enzyme was a hexamer with a subunit molecular weight of 20,600. The enzyme exhibited multiple activity bands on Polyacrylamide gel electrophoresis, which could be altered by treatment with carbamyl phosphate or UMP indicating that the enzyme was probably undergoing reversible association or dissociation in the presence of these effectors. The carbamyl phosphate stabilized enzyme did not exhibit positive homotropic interactions with carbamyl phosphate and hysteresis. The enzyme which had not been exposed to carbamyl phosphate showed a decrease in specific activity with a change in the concentration of both carbamyl phosphate and protein. The carbamyl phosphate saturation and U M P inhibition patterns were complex with a maximum and a plateau region. The partially purified enzyme also exhibited hysteresis and the hysteretic response, a function of protein concentration, was abolished by preincubation with carbamyl phosphate and enhanced by preincubation with UMP. All these observations are compatible with a postulation that the enzyme activity may be regulated by slow reversible association-dissociation dependent on the interaction with allosteric ligands.
Resumo:
Wheat is at peak quality soon after harvest. Subsequently, diverse biota use wheat as a resource in storage, including insects and mycotoxin-producing fungi. Transportation networks for stored grain are crucial to food security and provide a model system for an analysis of the population structure, evolution, and dispersal of biota in networks. We evaluated the structure of rail networks for grain transport in the United States and Eastern Australia to identify the shortest paths for the anthropogenic dispersal of pests and mycotoxins, as well as the major sources, sinks, and bridges for movement. We found important differences in the risk profile in these two countries and identified priority control points for sampling, detection, and management. An understanding of these key locations and roles within the network is a new type of basic research result in postharvest science and will provide insights for the integrated pest management of high-risk subpopulations, such as pesticide-resistant insect pests.
Resumo:
Isolated nuclei from differentiating cultures of Nicotiana sanderae showed increased levels of RNA polymerase activity as compared to the nuclei from callus cultures. The RNA synthetic activity was dependent on nucleotide triphosphates and Mg2+ and was destroyed by RNase. Maximum activity was obtained in the presence of 50 mM (NH4)2 SO4 and α-amanitin inhibited 40% and 55% of the activity in the nuclei from callus and differentiating tissue respectively. The nuclei from differentiating tissue elicited a 3-fold increase in RNA polymerase I and a 4-fold augmentation in RNA polymerase II activities.
Resumo:
Conformations of valinomycin and its complexes with Perchlorate and thiocyanate salts of barium, in a medium polar solvent acetonitrile, were studied using nuclear magnetic resonance spectroscopic techniques. Valinomycin was shown to have a bracelet conformation in acetonitrile. With the doubly charged barium ion, the molecule, at lower concentrations, predominantly formed a 1:1 complex. At higher concentrations, however, apart from the 1:1, peptide as well as ion sandwich complexes were formed in addition to a :final complex:. Unlike the standard 1:1 potassium complex, where the ion was centrally located in a bracelet conformation, the a 1:1 barium complex contained the barium ion at the periphery. The a :final complex: appeared to be an open conformation with no internal hydrogen bonds and has two bound barium ions. This complex was probably made of average of many closely related conformations that were exchanging very fast (on nuclear magnetic resonance time scale) among them. The conformation of the a:final complex a: resembled the conformation obtained in the solid state. Unlike the Perchlorate anion, the thiocyanate anion seemed to have a definite role in stabilising the various complexes. While the conformation of the 1:1 complex indicated a mechanism of ion capture at the membrane interface, the sandwich complexes might explain the transport process by a relay mechanism.
Resumo:
We have shown previously that the Ca2+-specific fluorescent dyes chlortetracycline (CTC) and indo-1/AM can be used to distinguish between prestalk and prespore cells in Dictyostelium discoideum at a very early stage. In the present study, pre- and post-aggregative amoebae of Dictyostelium discoideum were labelled with CTC or indo-1 and their fluorescence monitored after being drawn into a fine glass capillary. The cells rapidly form two zones of Ca2+-CTC or Ca2+-indo-1 fluorescence. Anterior (air side) cells display a high level of fluorescence; the level drops in the middle portion of the capillary and rises again to a lesser extent in the posteriormost cells (oil side). When bounded by air on both sides, the cells display high fluorescence at both ends. When oil is present at both ends of the capillary, there is little fluorescence except for small regions at the ends. These outcomes are evident within a couple of minutes of the start of the experiment and the fluorescence pattern intensifies over the course of time. By using the indicator neutral red, as well as with CTC and indo-1, we show that a band displaying strong fluorescence moves away from the anterior end before stabilizing at the anterior-posterior boundary. We discuss our findings in relation to the role of Ca2+ in cell-type differentiation in Dictyostelium discoideum.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
Plant regeneration from mesophyll protoplasts of pepper, Capsicum annuum L. cv. California Wonder has been demonstrated via shoot organogenesis, Protoplasts isolated from fully expanded leaves of 3-week-old axenic shoots when cultured in TM medium supplemented with 1 mgl(-1) NAA, 1 mgl(-1) 2, 4-D, 0.5 mgl(-1) BAP (CM 1) resulted in divisions with a frequency ranging from 20-25%. Antioxidant ascorbic acid and polyvinylpyrrolidone (PVP) in the medium and incubation in the dark helped overcome browning of protoplasts. Microcalli and macrocalli were formed in TM medium containing 2 mgl(-1) NAA and 0.5 mgl(-1) BAP (CM II) and MS gelled medium containing 2 mgl(-1) NAA and 0.5 mgl(-1) BAP (CM III), respectively, Regeneration of plantlets was possible via caulogenesis, Microshoots, 2-5 per callus appeared on MS gelled medium enriched with 0.5 mgl(-1) IAA, 2 mgl(-1) GA and 10 mgl(-1) BAP (CM IVc). Rooting of microshoots was obtained on half strength gelled medium containing 1 mgl(-1) NAA and 0.5 mgl(-1) BAP, Protoplasts isolated from cotyledons failed to divide and degenerated eventually.
Resumo:
Prediction of thermodynamic parameters of protein-protein and antigen-antibody complex formation from high resolution structural parameters has recently received much attention, since an understanding of the contributions of different fundamental processes like hydrophobic interactions, hydrogen bonding, salt bridge formation, solvent reorganization etc. to the overall thermodynamic parameters and their relations with the structural parameters would lead to rational drug design. Using the results of the dissolution of hydrocarbons and other model compounds the changes in heat capacity (DeltaCp), enthalpy (DeltaH) and entropy (DeltaS) have been empirically correlated with the polar and apolar surface areas buried during the process of protein folding/unfolding and protein-ligand complex formation. In this regard, the polar and apolar surfaces removed from the solvent in a protein-ligand complex have been calculated from the experimentally observed values of changes in heat capacity (DeltaCp) and enthalpy (DeltaH) for protein-ligand complexes for which accurate thermodynamic and high resolution structural data are available, and the results have been compared with the x-ray crystallographic observations. Analyses of the available results show poor correlation between the thermodynamic and structural parameters. Probable reasons for this discrepancy are mostly related with the reorganization of water accompanying the reaction which is indeed proven by the analyses of the energetics of the binding of the wheat germ agglutinin to oligosaccharides.
Resumo:
Modification of tryptophan side chains of soybean agglutinin (SBA) with N-bromosuccinimide results in a loss of the hemagglutinating and carbohydrate binding activities of the protein. One residue/subunit is probably essential for the binding activity. Modification leads to a large decrease in the fluorescene of the protein accompained by a blue shift. Iodide ion quenching of the protein fluorescence shows that saccharide binding results in a decreased accessibility of some of the tryptophan side chains. These results strongly point towards the involvement of tryptophan residues in the active site of SBA.
Resumo:
A model is presented which explains the biological role of the leader peptide in protein export. Along the lines of this model, the conformational changes of a protein with environment serves as a general mechanism for translocation. The leader peptide in the cytoplasm takes a hairpin like conformation which reverts to an extended helix upon integration into the membrane. The essential features of this model are in accord with recent results of protein export.
Resumo:
Gonadotropic hormones PMSG (15 IU/rat), FSH (3 mgrg/rat), LH (9 mgrg/rat) and hCG (3 mgrg/rat) were shown to decrease the free cytosolic lysosomal enzymes during the acute phase of hormone action in rat ovaries. When isolated cells from such rats were analyzed for the cathepsin-D activity, the granulosa cells of the ovary showed a reduction in the free as well as in the total lysosomal enzyme activities in response to FSH/PMSG; the stromal and thecal compartment of the ovary showed a reduction only in the free activity in response to hCG/PMSG. The results suggest the presence of two distinct, target cell specific, mechanisms by which the lysosmal activity of the ovary is regulated by gonadotropins.
Resumo:
Earlier we have demonstrated the presence of internal ribosome entry site (IRES) within tumor suppressor p53 mRNA. Here we have mapped the putative secondary structure of p53-IRES RNA using information from chemical probing and nuclease mapping experiments. Additionally, the secondary structure of the IRES element of the wild-type RNA was compared with cancer-derived silent mutant p53 RNAs. These mutations might result in the conformational alterations of p53-IRES RNAs. The results also indicate decreased IRES activities of the mutants as compared to wild-type RNA. Further, it was observed that some of the cytoplasmic trans-acting factors, critical for enhancing IRES function, were unable to bind mutant RNAs as efficiently as to wild-type. Our results suggest that hnRNP C1/C2 binds to p53-IRES and siRNA mediated partial silencing of hnRNP C1/C2 showed appreciable decrease in IRES function and consequent decrease in the level of the corresponding p53 isoform. Interestingly mutant p53 IRES showed lesser binding with hnRNP C1/C2 protein. Finally, upon doxorubicin treatment, the mutant RNAs were unable to show enhanced p53 synthesis to similar extent compared to wild type. Taken together, these observations suggest that mutations occurring in the p53 IRES might have profound implications for de-regulation of its expression and activity.
Resumo:
Most of the predisposition to hereditary breast and ovarian cancer has been attributed to inherited defects in two tumor suppressor genes BRCA1 and BRCA2. To explore the contribution of BRCA1 mutations to hereditary breast cancer among Indian women, we examined the coding sequence of the BRCA1 gene in 14 breast cancer patients with a positive family history of breast and/or ovarian cancer. Mutation analysis was carried out using conformation sensitive gel electrophoresis (CSGE) followed by sequencing. Three mutations (21%) in the BRCA1 gene were identified. Two of them are novel mutations of which one is a missense mutation in exon 7 near the RING finger domain, while the other is a one base pair deletion in exon 11 which results in protein truncation. The third mutation, 185delAG, has been previously described in Ashkenazi Jewish families. To our knowledge this is the first report of a study of germline BRCA1 mutation analysis in familial breast cancer in India. Our data from 14 different families suggests a lower prevalence but definite involvement of germline mutations in the BRCA1 gene among Indian women with breast cancer and a family history of breast cancer.