963 resultados para Nucleotide metabolites
Resumo:
Dialkyl phthalate esters (phthalates) are ubiquitous chemicals used extensively as plasticizers, solvents and adhesives in a range of industrial and consumer products. 1,2-Cyclohexane dicarboxylic acid, diisononyl ester (DINCH) is a phthalate alternative introduced due to a more favourable toxicological profile, but exposure is largely uncharacterised. The aim of this study was to provide the first assessment of exposure to phthalates and DINCH in the general Australian population. De-identified urine specimens stratified by age and sex were obtained from a community-based pathology laboratory and pooled (n = 24 pools of 100). Concentrations of free and total species were measured using online solid phase extraction isotope dilution high performance liquid chromatography tandem mass spectrometry. Concentrations ranged from 2.4 to 71.9 ng/mL for metabolites of di(2-ethylhexyl)phthalate, and from < 0.5 to 775 ng/mL for all other metabolites. Our data suggest that phthalate metabolites concentrations in Australia were at least two times higher than in the United States and Germany; and may be related to legislative differences among countries. DINCH metabolite concentrations were comparatively low and consistent with the limited data available. Ongoing biomonitoring among the general Australian population may help assess temporal trends in exposure and assess the effectiveness of actions aimed at reducing exposures.
Resumo:
The crystalline mung bean nucleotide pyrophosphatase was inhibited nonlinearly by AMP, one of the products of the reaction. The partially inactive enzyme was specifically reactivated by ADP, and V at maximal activation was the same as that of the native enzyme. ATP was a linear, noncompetitive inhibitor. The kinetic evidence suggested that ADP and ATP might not be reacting at the same site as AMP. The electrophoretic mobility of the enzyme was increased by AMP, whereas ADP and ATP were without effect. The enzyme was denatured on treatment with urea or guanidine hydrochloride. The renatured and the native enzyme had the same pH (9.4) and temperature (49 °C) optimum. The Km (0.2 mImage ) and V (3.2) of the native enzyme increased on renaturation to 1.8 mImage and 8.0, respectively. In addition, renaturation resulted in desensitization of the enzyme to inhibition by low concentrations of AMP. Renaturation did not affect the reactivation of the apoenzyme by Zn2+.
Resumo:
Epidemiological studies have associated high soy intake with a lowered risk for certain hormone-dependent diseases, such as breast and prostate cancers, osteoporosis, and cardiovascular disease. Soy is a rich source of isoflavones, diphenolic plant compounds that have been shown to possess several biological activities. Soy is not part of the traditional Western diet, but many dietary supplements are commercially available in order to provide the proposed beneficial health effects of isoflavones without changing the original diet. These supplements are usually manufactured from extracts of soy or red clover, which is another important source of isoflavones. However, until recently, detailed studies of the metabolism of these compounds in humans have been lacking. The aim of this study was to identify urinary metabolites of isoflavones originating from soy or red clover using gas chromatography - mass spectrometry (GC-MS). To examine metabolism, soy and red clover supplementation studies with human volunteers were carried out. In addition, the metabolism of isoflavones was investigated in vitro by identification of metabolites formed during a 24-h fermentation of pure isoflavones with a human fecal inoculum. Qualitative methods for identification and analysis of isoflavone metabolites in urine and fecal fermentation samples by GC-MS were developed. Moreover, a detailed investigation of fragmentation of isoflavonoids in electron ionization mass spectrometry (EIMS) was carried out by means of synthetic reference compounds and deuterated trimethylsilyl derivatives. After isoflavone supplementation, 18 new metabolites of isoflavones were identified in human urine samples. The most abundant urinary metabolites of soy isoflavones daidzein, genistein, and glycitein were found to be the reduced metabolites, i.e. analogous isoflavanones, a-methyldeoxybenzoins, and isoflavans. Metabolites having additional hydroxyl and/or methoxy substituents, or their reduced analogs, were also identified. The main metabolites of red clover isoflavones formononetin and biochanin A were identified as daidzein and genistein. In addition, reduced and hydroxylated metabolites of formononetin and biochanin A were identified; however, they occurred at much lower levels in urine samples than daidzein or genistein or their reduced metabolites. The results of this study show that the metabolism of isoflavones is diverse. More studies are needed to determine whether the new isoflavonoid metabolites identified here have biological activities that contribute to the proposed beneficial effects of isoflavones on human health. Another task is to develop validated quantitative methods to determine the actual levels of isoflavones and their metabolites in biological matrices in order to assess the role of isoflavones in prevention of chronic diseases.
Resumo:
The crystalline mung bean nucleotide pyrophosphatase was inhibited nonlinearly by AMP, one of the products of the reaction. The partially inactive enzyme was specifically reactivated by ADP, and V at maximal activation was the same as that of the native enzyme. ATP was a linear, noncompetitive inhibitor. The kinetic evidence suggested that ADP and ATP might not be reacting at the same site as AMP. The electrophoretic mobility of the enzyme was increased by AMP, whereas ADP and ATP were without effect. The enzyme was denatured on treatment with urea or guanidine hydrochloride. The renatured and the native enzyme had the same pH (9.4) and temperature (49 °C) optimum. The Km (0.2 m ) and V (3.2) of the native enzyme increased on renaturation to 1.8 m and 8.0, respectively. In addition, renaturation resulted in desensitization of the enzyme to inhibition by low concentrations of AMP. Renaturation did not affect the reactivation of the apoenzyme by Zn2+.
Resumo:
Abstract is not available.
Resumo:
CRYSTAL structure determinations of nucleic acid fragments have shown that several of the conformational features found in the monomeric building blocks are also manifested at the nucleic acid level. Stereochemical variations between thymine and uracil nucleotides are therefore of interest as they can provide a structural basis for some of the differences between the conformations of DNA and RNA. X-ray studies have so far not shown any major dissimilarities between these two nucleotide species although the sugar ring of deoxyribonucleotides is found to possess greater flexibility than that in ribonucleotides. We report here the molecular structure of deoxyuridine-5'-phosphate (dUMP-5') which is not a common monomer unit of DNAs as it is replaced by its 5-methyl analogue deoxythymidine-5'-phosphate (dTMP-5'). The investigation was undertaken to help determine whether or not this implied a fundamental difference between the geometries of these two molecules.
Resumo:
Acta Crystallographica Section A: Foundations of Crystallography covers theoretical and fundamental aspects of the structure of matter. The journal is the prime forum for research in diffraction physics and the theory of crystallographic structure determination by diffraction methods using X-rays, neutrons and electrons. The structures include periodic and aperiodic crystals, and non-periodic disordered materials, and the corresponding Bragg, satellite and diffuse scattering, thermal motion and symmetry aspects. Spatial resolutions range from the subatomic domain in charge-density studies to nanodimensional imperfections such as dislocations and twin walls. The chemistry encompasses metals, alloys, and inorganic, organic and biological materials. Structure prediction and properties such as the theory of phase transformations are also covered.
Resumo:
The addition of AMP to the crystalline and homogeneous mung bean nucleotide pyrophosphatase [EC 3.6.1.9]altered its electrophoretic mobility. AMP was tightly bound to the enzyme and was not removed on passage through a column of Sephadex G-25 or on electrophoresis. The molecular weight of the native and AMP-modified enzymes were 65,000 and 136,000, respectively. The properties of the native enzyme such as the pH (9.4) and temperature (49 °C) optima, inhibition by EDTA, reversal of EDTA-inhibition by Zn2+ and Co2+, were not altered on dimerization by AMP. The AMP-modified enzyme had a linear time-course of reaction, unlike the native enzyme which exhibited a biphasic time-course of reaction. The AMP-modified enzyme was irreversibly denatured by urea. AMP concentrations larger than 100 μM inhibited linearly the activity of the AMP-modified enzyme. ADP and ATP inhibited the activity in a sigmoidal manner. Km and V of the native and AMP-modified enzymes were, 0.25 mImage and 0.58 mImage ; and 3.3 and 2.5, respectively.
Resumo:
A model (NADH-phenazine methosulfate-O2) formally similar to pyridine nucleotide-dependent flavoprotein hydroxylases catalyzed the hydroxylation of several aromatic compounds. The hydroxylation was maximal at acid pH and was inhibited by ovine Superoxide dismutase, suggesting that perhydroxyl radicals might be intermediates in this process. The stoichiometry of the reaction indicated that a univalent reduction of oxygen was occurring. The correlation between the concentration of semiquinone and hydroxylation, and the inhibition of hydroxylation by ethanol which inhibited semiquinone oxidation, suggested the involvement of phenazine methosulfate-semiquinone. Activation of hydroxylation by Fe3+ and Cu2+ supported the contention that univalently reduced species of oxygen was involved in hydroxylation. Catalase was without effect on the hydroxylation by the model, ruling out H2O2 as an intermediate. A reaction sequence, involving a two-electron reduction of phenazine methosulfate to reduced phenazine methosulfate followed by disproportionation with phenazine methosulfate to generate the semiquinone, was proposed. The semiquinone could donate an electron to O2 to generate O2 which could be subsequently protonated to form the perhydroxyl radical.
Resumo:
The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
We have determined relative levels of chloroplast leucine and tyrosine isoaccepting tRNAs and modified nucleotide contents from total tRNAs isolated from dark-grown, light-grown, N6-isopentenyladenine (i6A)-treated dark-grown and i6A-treated light-grown cucumber seedlings. Significant increases in the relative amounts of tRNA(Leu)2 and tRNA(Leu)3 were observed in the i6A-treated dark-grown seedlings compared to dark-grown, light-grown and i6A-treated light-grown seedlings. On the other hand, i6A-treated light-grown seedlings tRNA(Tyr)1 increased to 85% of total tRNAs(Tyr) from about 9% in light-grown seedlings and tRNA(Tyr)2 decreased to 15% compared with 91% in light-grown seedlings. Analysis of modified nucleotide of total tRNAs indicated that pT, pI, pm1A, pm5C, pGm, pm1G, pm2G and pm7G contents were significantly higher in the total tRNA of i6A-treated dark-grown seedlings than those from untreated dark-grown seedlings. Illumination of 8-day-old dark-grown seedlings for 12 h increased the contents of pT, pI, pGm and pm1G when compared to 8-day-old dark-grown seedlings with extended growth for 12 h in dark. On the contrary, i6A had no stimulatory effect in the contents of modified nucleotide in the light-grown seedlings.
Resumo:
Crystal structures of lithium, sodium, potassium, calcium and magnesium salts of adenosine 2'-monophosphate (2'-AMP) have been obtained at atomic resolution by X-ray crystallographic methods. 2'-AMP.Li belongs to the monoclinic space group P21 with a = 7.472(3)Å, b = 26.853(6) Å, c = 9.184(1)Å, b = 113.36(1)Å and Z= 4. 2'-AMP.Na and 2'-AMP.K crystallize in the trigonal space groups P31 and P3121 with a = 8.762(1)Å, c = 34.630(5)Å, Z= 6 and a = 8.931(4), Åc = 34.852(9)Å and Z= 6 respectively while 2'-AMP.Ca and 2'-AMP.Mg belong to space groups P6522 and P21 with cell parameters a = 9.487(2), c = 74.622(13), Z = 12 and a = 4.973(1), b = 10.023(2), c = 16.506(2), beta = 91.1(0) and Z = 2 respectively. All the structures were solved by direct methods and refined by full matrix least-squares to final R factors of 0.033, 0.028, 0.075, 0.069 and 0.030 for 2'-AMP.Li, 2'-AMP.Na, 2'- AMP.K, 2'-AMP.Ca and 2'-AMP.Mg, respectively. The neutral adenine bases in all the structures are in syn conformation stabilized by the O5'-N3 intramolecular hydrogen bond as in free acid and ammonium complex reported earlier. In striking contrast, the adenine base is in the anti geometry (cCN = -156.4(2)°) in 2'-AMP.Mg. Ribose moieties adopt C2'-endo puckering in 2'-AMP.Li and 2'-AMP.Ca, C2'-endo-C3'-exo twist puckering in 2'-AMP.Na and 2'-AMP.K and a C3'-endo-C2'-exo twist puckering in 2'-AMP.Mg structure. The conformation about the exocyclic C4'-C5' bond is the commonly observed gauche-gauche (g+) in all the structures except the gauche- trans (g-) conformation observed in 2'-AMP.Mg structure. Lithium ions coordinate with water, ribose and phosphate oxygens at distances 1.88 to 1.99Å. Na+ ions and K+ ions interact with phosphate and ribose oxygens directly and with N7 indirectly through a water oxygen. A distinct feature of 2'-AMP.Na and 2'-AMP.K structures is the involvement of ribose O4' in metal coordination. The calcium ion situated on a two-fold axis coordinates directly with three oxygens OW1, OW2 and O2 and their symmetry mates at distances 2.18 to 2.42Å forming an octahedron. A classic example of an exception to the existence of the O5'-N3 intramolecular hydorgen bond is the 2'-AMP.Mg strucure. Magnesium ion forms an octahedral coordination with three water and three phosphate oxygens at distances ranging from 2.02 to 2.11Å. A noteworthy feature of its coordination is the indirect link with N3 through OW3 oxygen resulting in macrochelation between the base and the phosphate group. Greater affnity of metal clays towards 5' compared to 2' and 3' nucleotides (J. Lawless, E. Edelson, and L. Manring, Am. Chem. Soc. Northwest Region Meeting, Seattle. 1978) due to macrochelation infered from solution studies (S. S. Massoud, H. Sigel, Eur. J. Biochem. 179, 451-458 (1989)) and interligand hydrogen bonding induced by metals postulated from metal-nucleotide structures in solid state (V. Swaminathan and M. Sundaralingam, CRC. Crit. Rev. Biochem. 6, 245-336 (1979)) are borne out by our structures also. The stacking patterns of adenine bases of both 2'-AMP.Na and 2'-AMP.K structures resemble the 2'-AMP.NH4 structure reported in the previous article. 2'-AMP.Li, 2'-AMP.Ca and 2'-AMP.Mg structures display base-ribose O4' stacking. An overview of interaction of monovalent and divalent cations with 2' and 5'-nucleotides has been presented.