101 resultados para DMSO
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
To evaluate the cytotoxicity of dimethyl sulfoxide (DMSO) on the repair-related activity of cultured odontoblast-like MDPC-23 cells. Methods Solutions with different concentrations of DMSO (0.05, 0.1, 0.3, 0.5 and 1.0 mM), diluted in culture medium (DMEM), were placed in contact with MDPC-23 cells (5 × 104 cells/cm2) for 24 h. Eight replicates (n = 8) were prepared for each solutions for the following methods of analysis: violet crystal dye for cell adhesion (CA), quantification of total protein (TP), alizarin red for mineralization nodules formation (MN) and cell death by necrosis (flow cytometry); while twelve replicates (n = 12) were prepared for viable cell number (Trypan Blue) and cell viability (MTT assay). Data were analyzed by ANOVA and Tukey or Kruskal–Wallis and Mann–Whitney's tests (p < 0.05). Results Cell viability, adhesion and percentage of cell death by necrosis were not affected by DMSO at any concentration, with no statistical significant difference among the groups. A significant reduction in total protein production was observed for 0.5 and 1.0 mM of DMSO compared to the control while increased mineralized nodules formation was seen only for 1.0 mM DMSO. Significance: DMSO caused no or minor cytotoxic effects on the pulp tissue repair-related activity of odontoblast-like cells.
Resumo:
Tissue repair after replantation of avulsed teeth is directly related to the extent of damage to the cells of the periodontal ligament. Thus, immediate replantation is the treatment of choice for avulsed permanent teeth. To achieve more favorable prognostics, adequate storage media must be used to preserve periodontal ligament cells. A series of storage media are studied and show good results, such as saliva, milk, Hank's balanced solution (HBSS) and ViaSpan. However, recent studies were performed using news and promising storage media. Resveratrol has been extensively studied because of its antioxidant properties and its ability to prolong life of many organisms from yeast to mammals. One of its limitations is its poor solubility in aqueous vehicles. For this reason, the aim of this study was to evaluate the healing repair process after replantation of teeth of rats kept in Resveratrol using dimethyl sulfoxide (DMSO) as a vehicle. This study was approved by the Ethics Committee on Research with Animals, of the School of Dentistry of Araçatuba, Univ. Estadual Paulista, UNESP, Araçatuba, SP, Brazil. Were used 40 male rats, under general anesthesia upper right incisor were extracted and replanted. Treatments were done, dividing in four groups, of 10 animals each. In group I, the teeth were be extracted and immediately replanted into their sockets of origin (positive control). In group II, the teeth were immersed in 50 mL of resveratrol in DMSO (0.0512 g / ml) for 60 minutes. In group III teeth were kept for 60 minutes in 50 ml of DMSO. In group IV, the teeth were kept in dry for the same period (negative control). Then the teeth of animals in Groups II, III and IV were replanted in their sockets. Systemic antibiotics were administrated in all groups, and 60 days post-operative the animals were euthanized. The specimens were processed and stained in HE for histomorphological analysis. The results showed that resveratrol as storage media, was not able to improve the rep
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
This study was undertaken to compare cryotolerance, in terms of viability and resumption of meiosis after warming and culture (24 and 48 h), of ex situ (isolated) and in situ (enclosed in the ovarian tissue) feline cumulusoocyte complexes (COCs) vitrified with DAP 213 (2 M DMSO, 1 M acetamide, 3 M propylene glycol) in cryotubes or Cryotop method. Ovaries were harvested from 49 pubertal queens. of each pair of ovaries, one was dissected to release COCs randomly divided into three groups: fresh COCs (control), ex situ COCs vitrified with DAP 213 and Cryotop. The cortex of the other ovary was sectioned into small fragments (approximately 1.5 mm3) and randomly assigned to be vitrified by DAP 213 or Cryotop. After warming, ex situ and in situ (retrieved form vitrified ovarian tissue) COCs were matured in vitro. Viability of oocytes was highly preserved after warming and culture in all treatments. Proportions of oocytes surrounded by complete layers of viable cumulus cells were remarkably decreased (p < 0.00001) in both vitrification procedures compared to fresh oocytes. Resumption of meiosis occurred in all treatments. After 24 h of culture, results were similar in ex situ and in situ vitrified oocytes regardless of the vitrification protocol used (range 29-40%), albeit lower (p < 0.05) than those of fresh oocytes (65.8%). After 48 h of culture, ex situ oocytes vitrified with Cryotop achieved the rates of meiosis resumption similar to fresh oocytes (53.8% vs 67.5%; p > 0.05) and ex situ and in situ oocytes vitrified with DAP 213 showed similar rates of resumption of meiosis. These findings demonstrated that DAP 213 and Cryotop preserve the viability of ex situ and in situ oocytes, but cumulus cells are highly susceptible to vitrification. However, the capability to resume meiosis evidences that feline immature oocytes vitrified as isolated or enclosed in the ovarian cortex have comparable cryotolerance.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Objetivou-se com o presente trabalho, estabelecer a relação entre os pigmentos fotossintéticos extraídos em DMSO e as leituras obtidas no clorofilômetro portátil ClorofiLOG® 1030, gerando modelos matemáticos capazes de predizer os teores de clorofila e de carotenóides em folhas de mamoneira. O trabalho foi conduzido na Empresa Brasileira de Pesquisa Agropecuária (EMBRAPA) Algodão, situada em Campina Grande, Estado da Paraíba, em outubro de 2010. Para a análise indireta, foi utilizado um equipamento portátil, sendo realizada a leitura em discos foliares com diferentes tonalidades de verde, sendo feita, nesses mesmos discos, a determinação da clorofila pelo método clássico. Para a extração da clorofila, utilizaram-se 5 mL de dimetilsulfóxido (DMSO), a qual foi mantida em banho-maria a 70ºC, por 30 minutos, e retirou-se 3 mL da alíquota para leitura em espectrofotômetro nos comprimentos de onda de 470, 646 e 663 nm. Os dados foram submetidos à análise da variância e regressão polinomial. A leitura obtida no clorofilômetro portátil foi a variável dependente, e os pigmentos fotossintéticos determinados pelo método clássico foi a variável independente. Os resultados indicaram que o clorofilômetro portátil ClorofiLOG® 1030, associado a modelos matemáticos, permitiu estimar a concentração dos pigmentos fotossintéticos, exceto a clorofila b, com alta precisão, com economia de tempo e com reagentes normalmente utilizados nos procedimentos convencionais.
Resumo:
Two alkaloids, erysodine (1) and erysothrine (2) were isolated from the flowers of a Pakistani medicinal plant, Erythrina suberosa. These compounds were investigated for anxiolytic properties, and the results showed significant effect, in an acute oral treatment with 1-2, which were suspended in saline (NaCl 0.9%) plus DMSO 1%, and evaluated in 122 Swiss male mice exposed to two tests of anxiety - the elevated plus-maze (EPM) and the light/dark transition model (LDTM).
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)