Detection of bovine herpesvirus 5 (BoHV-5) in formalin-fixed, paraffin-embedded bovine brain by nested PCR in Colombian cattle

Fifteen cases of viral meningoencephalitis in Colombian cattle were tested by nested PCR analysis for the detection of bovine herpesvirus 5 (BoHV-5). All fatal cases had shown severe neurological signs and had occurred following natural outbreaks of the disease. The neurological infection was histologically characterized by mild to moderate inflammatory changes in the brain and cerebellum, including meningitis, mononuclear perivascular cuffing, gliosis, haemorrhage, and the presence of Gitter cells (macrophages) accompanying large areas of malacia. No intranuclear inclusion bodies were seen in any of the cases. Results from BoHV-5 molecular extraction analyses showed there were five positive cases thus confirming the presence of the virus in Colombia.

Molecular differentiation of Salmonella Gallinarum and Salmonella Pullorum by RFLP of fliC gene from Brazilian isolates

Although Salmonella Pullorum and Salmonella Gallinarum cause different diseases in poultry, they are very similar. Both are non-motile and present the same somatic antigenic structure. They are differentiated by biochemical tests. Certain atypical strains are very difficult to distinguish. They do not produce the expected results when dulcitol and ornithine descarxboxylase tests are performed. Therefore, additional tests could be helpful. Many studies have chose the part I of the gene that encodes flagellin (fliC) to differentiate serotypes. Most Salmonella strains have two structural genes (fliC and fliB) that encode flagellins. Non-motile strains generally present these structural genes, but are not able to build a functional flagellum. It was demonstrated that enzymatic restriction of the amplified fliC gene using Hinp1I enzyme can differentiate SG from SP. In the present study, this method was adopted to analyze 14 SP and 22 SG strains, including some strains with atypical results in biochemical tests assessing the utilization of dulcitol and ornithine. The results showed that all SG strains were broken by the enzyme, whereas the 14 SP strains were not.

Sensitivity evaluation of a single-step PCR assay using Ehrlichia canis p28 gene as a target and its application in diagnosis of canine ehrlichiosis

O objetivo deste estudo foi aperfeiçoar um ensaio de PCR que amplificasse um fragmento de 843 pares de bases do gene p28 da Ehrlichia canis e compará-lo com outros dois métodos de PCR utilizados para amplificar partes do gene 16S rRNA e dsb do gênero Ehrlichia. Amostras sanguíneas foram colhidas de cães com diagnóstico clínico de erliquiose. A amplificação do gene p28 pela PCR produziu um fragmento de 843pb e esse ensaio permitiu a detecção do DNA de um parasita dentre 1 bilhão de células. Todas as amostras positivas detectadas pela PCR baseada no gene p28 foram também positivas pela nested PCR para detecção do gene 16S rRNA e também pela PCR dsb. Dentre as amostras negativas para a PCR p28, 55,3% foram co-negativas, mas 27,6% foram positivas pela PCR baseada nos genes 16S rRNA e dsb. A PCR p28 parece ser um teste útil para detecção molecular de E. canis, entretanto otimizações na sensibilidade nesta PCR são necessárias, para que esta técnica se torne uma importante alternativa no diagnóstico da erliquiose canina.

A nested-PCR assay for detection of Xylella fastidiosa in citrus plants and sharpshooter leafhoppers

Aims: Detection of Xylella fastidiosa in citrus plants and insect vectors.Methods and Results: Chelex 100 resin matrix was successfully standardized allowing a fast DNA extraction of X. fastidiosa. An amplicon of 500 bp was observed in samples of citrus leaf and citrus xylem extract, with and without symptoms of citrus variegated chlorosis, using PCR with a specific primer set indicating the presence of X. fastidiosa. The addition of insoluble acid-washed polyvinylpyrrolidone (PVPP) prior to DNA extraction of insect samples using Chelex 100 resin together with nested-PCR permitted the detection of X. fastidiosa within sharpshooter heads with great sensitivity. It was possible to detect up to two bacteria per reaction. From 250 sharpshooter samples comprising four species (Dilobopterus costalimai, Oncometopia facialis, Bucephalogonia xanthopis and Acrogonia sp.), 87 individuals showed positive results for X. fastidiosa in a nested-PCR assay.Conclusions: the use of Chelex 100 resin allowed a fast and efficient DNA extraction to be used in the detection of X. fastidiosa in citrus plants and insect vectors by PCR and nested-PCR assays, respectively.Significance and Impact of the study: the employment of efficient and sensitive methods to detect X. fastidiosa in citrus plants and insect vectors will greatly assist epidemiological studies.

Selection and validation of reference genes for gene expression studies by reverse transcription quantitative PCR in Xanthomonas citri subsp citri during infection of Citrus sinensis

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Distinctively variable sequence-based nuclear DNA markers for multilocus phylogeography of the soybean- and rice-infecting fungal pathogen Rhizoctonia solani AG-1 IA

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Associations of FASN gene polymorphisms with economical traits in Nellore cattle (Bos primigenius indicus)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Further characterization of two sequiviruses infecting lettuce and development of specific RT-PCR primers

Lettuce mottle virus (LeMoV) and dandelion yellow mosaic virus (DaYMV) infect lettuce in South America and Europe, respectively. LeMoV and DaYMV possess isometric particles, occur at low concentrations in plants and have narrow host ranges. Partial genome sequences of both viruses were obtained using purified viral preparations and universal primers for members of the family Sequiviridae. DaYMV and LeMoV sequences were analyzed and showed identity with other members of the family. Universal primers that detect both viruses and specific primers for LeMoV and DaYMV were designed and used in RT-PCR-based diagnostic assays. These results provide the first molecular data on the LeMoV and DaYMV genomes and suggest that LeMoV is a member of the genus Sequivirus, probably distinct from DaYMV.

Only the B biotype of Bemisia tabaci is present on vegetables in São Paulo State, Brazil

Bemisia tabaci (Genn.) é considerada uma das mais importantes pragas em cultivos de hortaliças e ornamentais em todo o mundo. Baseado na análise da seqüência mitocondrial (citocromo oxidase I - mtCOI) foi proposto recentemente que B. tabaci deva ser considerado um complexo críptico de espécies, contendo 11 grupos e 24 espécies. Dois destes grupos: Middle East-Asia Minor e Mediterranean englobam os biótipos B e Q, respectivamente. Avaliou-se a sequência mtCOI de espécimes de B. tabaci coletados em regiões do estado de São Paulo, Brasil. Por PCR-RFLP utilizando-se a enzima Taq I, pôde-se observar somente o padrão típico de clivagem para o biótipo B. Comparando-se com sequências consenso, todas as moscas brancas foram classificadas no grupo Middle East-Asia Minor e puderam ser separadas em quatro haplótipos, indicando prevalência do biótipo B em áreas de pimentão (Capsicum annuum L.), tomate (Solanum lycopersicum L.), cucurbitáceas e berinjela (Solanum melongena L.) do Estado de São Paulo.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Grapevine bacterial canker in the State of São Paulo, Brazil: detection and eradication

Sintomas do cancro bacteriano da videira na variedade Red Globe foram observados em agosto de 2009 em pomar de Tupi Paulista, Estado de São Paulo, Brasil, e o agente causal Xanthomonas campestris pv. viticola foi identificado por meio de testes patológicos e moleculares. O procedimento de erradicação foi adotado e aproximadamente 4.700 plantas foram destruídas. Um levantamento realizado nas regiões produtoras do Estado de São Paulo não encontrou nenhum outro pomar contaminado, e essa espécie bacteriana é considerada ausente neste estado.

Ocorrência e variabilidade genética do Tomato severe rugose virus em tomateiro e pimentão no Estado de São Paulo

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Bidens mosaic virus: detecção via RT-PCR e identificação de Galinsoga parviflora como um novo hospedeiro natural do vírus

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Strains of Xylella fastidiosa rapidly distinguished by arbitrarily primed-PCR

Genomic DNAs isolated from strains of Xylella fastidiosa that caused citrus variegated chlorosis, coffee leaf scorch, Pierce's Disease of grapevine, and plum leaf scorch were analyzed by arbitrarily primed polymerase chain reaction. Purified DNA was amplified under nonstringent conditions with single primers 21 nucleotides (nt) long. Thirty-nine amplification products were observed that were useful to distinguish among the strains and to derive a similarity matrix and construct a phenogram showing possible relationships among the strains. Strains isolated from diseased coffee and citrus in Brazil were closely related to each other (coefficient of similarity of 0.872), but only distantly related to a strain isolated from diseased grapevine in the USA (coefficient of similarity of 0.650). Strains of Xylella fastidiosa isolated from diseased plums in the USA and Brazil clustered with strains from different hosts isolated from their respective countries of origin. Thus, there may be two quite dissimilar clusters of strains of Xylella fastidiosa, one in North America and the other in South America. Each cluster contains strains that can cause disease in plum. The methods described provide a convenient and rapid method to distinguish between strains of Xylella fastidiosa that cause diseases of coffee and citrus in the same region of Brazil. This has not been possible previously. This will potentially enable the two strains to be distinguished in alternate hosts or in insect vectors.