49 resultados para Chloroplast genome
em Indian Institute of Science - Bangalore - Índia
Resumo:
India has been acknowledged as a large reservoir of nature's random mutation, an original 'rich' source of knowledge in the context of international genome studies. Human genome knowledge and the possible understanding of the basis of uniqueness of each individual in chemical terms has presented a number of inescapable challenges to our own jurisprudence philosophies and our ethical sensibilities.
Resumo:
Although LH is essential for survival and function of the corpus luteum (CL) in higher primates, luteolysis occurs during nonfertile cycles without a discernible decrease in circulating LH levels. Using genome-wide expression analysis, several experiments were performed to examine the processes of luteolysis and rescue of luteal function in monkeys. Induced luteolysis with GnRH receptor antagonist (Cetrorelix) resulted in differential regulation of 3949 genes, whereas replacement with exogenous LH (Cetrorelix plus LH) led to regulation of 4434 genes (1563 down-regulation and 2871 up-regulation). A model system for prostaglandin (PG) F-2 alpha-induced luteolysis in the monkey was standardized and demonstrated that PGF(2 alpha) regulated expression of 2290 genes in the CL. Analysis of the LH-regulated luteal transcriptome revealed that 120 genes were regulated in an antagonistic fashion by PGF(2 alpha). Based on the microarray data, 25 genes were selected for validation by real-time RT-PCR analysis, and expression of these genes was also examined in the CL throughout the luteal phase and from monkeys treated with human chorionic gonadotropin (hCG) to mimic early pregnancy. The results indicated changes in expression of genes favorable to PGF(2 alpha) action during the late to very late luteal phase, and expressions of many of these genes were regulated in an opposite manner by exogenous hCG treatment. Collectively, the findings suggest that curtailment of expression of downstream LH-target genes possibly through PGF(2 alpha) action on the CL is among the mechanisms underlying cross talk between the luteotropic and luteolytic signaling pathways that result in the cessation of luteal function, but hCG is likely to abrogate the PGF(2 alpha)-responsive gene expression changes resulting in luteal rescue crucial for the maintenance of early pregnancy. (Endocrinology 150: 1473-1484, 2009)
Resumo:
One-quarter of the total primary production on earth is contributed by diatoms1. These are photosynthetic, unicellular algae with ornamented silica shells found in all aquatic and moist environments. They form the base of energy-efficient food webs that support all aquatic life forms. More than 250 genera of living diatoms, with as many as 100,000 species are known2. Fossil diatoms are known as early as the Cretaceous, 144–65 m.y. ago3. In India, deposits of diatoms occur in Rajasthan and are known as ‘multani mitti’. Multani mitti or Indian Fuller’s earth or diatomaceous earth as it is called in the West, is applied as a paste on the surface of the skin for 15–20 min and then washed-off. This leaves the skin feeling smooth, soft, moist and rejuvenated. Diatomaceous earth is now being used in the formulation of soaps, cleansing products, face powders and skincare preparations. Diatomaceous earth is a mineral material consisting mainly of siliceous fragments of various species of fossilized remains of diatoms.
Resumo:
Background: Tuberculosis still remains one of the largest killer infectious diseases, warranting the identification of newer targets and drugs. Identification and validation of appropriate targets for designing drugs are critical steps in drug discovery, which are at present major bottle-necks. A majority of drugs in current clinical use for many diseases have been designed without the knowledge of the targets, perhaps because standard methodologies to identify such targets in a high-throughput fashion do not really exist. With different kinds of 'omics' data that are now available, computational approaches can be powerful means of obtaining short-lists of possible targets for further experimental validation. Results: We report a comprehensive in silico target identification pipeline, targetTB, for Mycobacterium tuberculosis. The pipeline incorporates a network analysis of the protein-protein interactome, a flux balance analysis of the reactome, experimentally derived phenotype essentiality data, sequence analyses and a structural assessment of targetability, using novel algorithms recently developed by us. Using flux balance analysis and network analysis, proteins critical for survival of M. tuberculosis are first identified, followed by comparative genomics with the host, finally incorporating a novel structural analysis of the binding sites to assess the feasibility of a protein as a target. Further analyses include correlation with expression data and non-similarity to gut flora proteins as well as 'anti-targets' in the host, leading to the identification of 451 high-confidence targets. Through phylogenetic profiling against 228 pathogen genomes, shortlisted targets have been further explored to identify broad-spectrum antibiotic targets, while also identifying those specific to tuberculosis. Targets that address mycobacterial persistence and drug resistance mechanisms are also analysed. Conclusion: The pipeline developed provides rational schema for drug target identification that are likely to have high rates of success, which is expected to save enormous amounts of money, resources and time in the drug discovery process. A thorough comparison with previously suggested targets in the literature demonstrates the usefulness of the integrated approach used in our study, highlighting the importance of systems-level analyses in particular. The method has the potential to be used as a general strategy for target identification and validation and hence significantly impact most drug discovery programmes.
Resumo:
2,3-Dihydroxybenzoate-2,3-oxygenase is mainly localized in the soluble and the chloroplast fractions of Tecoma leaves. It is associated with the lamellar structure of the chloroplast fraction. The chloroplast enzyme has properties similar to those of the soluble enzyme, but it has a longer half-life and is more stable to dialysis than the soluble enzyme. It is inhibited by sulfhydryl reagents and the inhibition is reversed by the addition of reduced glutathione. The chloroplast enzyme is insensitive to iron-chelating agents. The enzyme loses activity on dialysis against copper-chelating agents and the activity is completely recovered on the addition of copper; addition of iron does not restore the activity. Polyphenol oxidase is probably present only in the active form in the Tecoma chloroplast but it is not involved in the intradiol cleavage of 2,3-dihydroxybenzoic acid.
Resumo:
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.
Resumo:
The complete genome of the baker's yeast S. cerevisiae was analyzed for the presence of polypurine/polypyrimidine (poly[pu/py]) repeats and their occurrences were classified on the basis of their location within and outside open reading frames (ORFs). The analysis reveals that such sequence motifs are present abundantly both in coding as well as noncoding regions. Clear positional preferences are seen when these tracts occur in noncoding regions. These motifs appear to occur predominantly at a unit nucleosomal length both upstream and downstream of ORFs. Moreover, there is a biased distribution of polypurines in the coding strands when these motifs occur within open reading frames. The significance of the biased distribution is discussed with reference to the occurrence of these motifs in other known mRNA sequences and expressed sequence tags. A model for cis regulation of gene expression is proposed based on the ability of these motifs to form an intermolecular triple helix structure when present within the coding region and/or to modulate nucleosome positioning via enhanced histone affinity when present outside coding regions.
Resumo:
The rapid increase in genome sequence information has necessitated the annotation of their functional elements, particularly those occurring in the non-coding regions, in the genomic context. Promoter region is the key regulatory region, which enables the gene to be transcribed or repressed, but it is difficult to determine experimentally. Hence an in silico identification of promoters is crucial in order to guide experimental work and to pin point the key region that controls the transcription initiation of a gene. In this analysis, we demonstrate that while the promoter regions are in general less stable than the flanking regions, their average free energy varies depending on the GC composition of the flanking genomic sequence. We have therefore obtained a set of free energy threshold values, for genomic DNA with varying GC content and used them as generic criteria for predicting promoter regions in several microbial genomes, using an in-house developed tool `PromPredict'. On applying it to predict promoter regions corresponding to the 1144 and 612 experimentally validated TSSs in E. coli (50.8% GC) and B. subtilis (43.5% GC) sensitivity of 99% and 95% and precision values of 58% and 60%, respectively, were achieved. For the limited data set of 81 TSSs available for M. tuberculosis (65.6% GC) a sensitivity of 100% and precision of 49% was obtained.
Resumo:
The current explosion of DNA sequence information has generated increasing evidence for the claim that noncoding repetitive DNA sequences present within and around different genes could play an important role in genetic control processes, although the precise role and mechanism by which these sequences function are poorly understood. Several of the simple repetitive sequences which occur in a large number of loci throughout the human and other eukaryotic genomes satisfy the sequence criteria for forming non-B DNA structures in vitro. We have summarized some of the features of three different types of simple repeats that highlight the importance of repetitive DNA in the control of gene expression and chromatin organization. (i) (TG/CA)n repeats are widespread and conserved in many loci. These sequences are associated with nucleosomes of varying linker length and may play a role in chromatin organization. These Z-potential sequences can help absorb superhelical stress during transcription and aid in recombination. (ii) Human telomeric repeat (TTAGGG)n adopts a novel quadruplex structure and exhibits unusual chromatin organization. This unusual structural motif could explain chromosome pairing and stability. (iii) Intragenic amplification of (CTG)n/(CAG)n trinucleotide repeat, which is now known to be associated with several genetic disorders, could down-regulate gene expression in vivo. The overall implications of these findings vis-à-vis repetitive sequences in the genome are summarized.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.
Resumo:
The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA- treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had not detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These date indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.
Resumo:
The relative amounts of chloroplast tRNAs(Leu), tRNA(Glu), tRNA(Phe), tRNAs(Thr), and tRNA(Tyr) and of chloroplastic and cytoplasmic aminoacyl-tRNA synthetases were compared in green leaves, yellowing senescing leaves, and N(6)-benzyladenine-treated senescing leaves from bean (Phaseolus vulgaris, var Contender). Aminoacylation of the tRNAs using Escherichia coli aminoacyl-tRNA synthetases indicated that in senescing leaves the relative amount of chloroplast tRNA(Phe) was significantly lower than in green leaves. Senescing leaves treated with N(6)-benzyladenine contained higher levels of this tRNA than untreated senescing leaves. No significant change in the relative amounts of chloroplast tRNAs(Leu), tRNAs(Thr), and tRNA(Tyr) was detected in green, yellow senescing, or N(6)-benzyladine-treated senescing leaves. Relative levels of chloroplast tRNAs were also estimated by hybridization of tRNAs to DNA blots of gene specific probes. These experiments confirmed the results obtained by aminoacylation and revealed in addition that the relative level of chloroplast tRNA(Glu) is higher in senescing leaves than in green leaves. Transcription run-on assays indicated that these changes in tRNA levels are likely to be due to a differential rate of degradation rather than to a differential rate of transcription of the tRNA genes. Chloroplastic and cytoplasmic leucyl-, phenylalanyl-, and tyrosyl-tRNA synthetase activities were greatly reduced in senescing leaves as compared to green leaves, whereas N(6)-benzyladenine-treated senescing leaves contained higher enzyme activities than untreated senescing leaves. These results suggest that during senescence, as well as during senescence-retardation by cytokinins, changes in enzyme activities, such as aminoacyl-tRNA synthetases, rather than reduced levels of tRNAs, affect the translational capacity of chloroplasts.
Resumo:
The phosphoprotein P of paramyxoviruses is known to play more than one role in genome transcription and replication. Phosphorylation of P at the NH2 terminus by cellular casein kinase II has been shown to be necessary for transcription of the genome in some of the viruses, while it is dispensable for replication. The phosphorylation null mutant of rinderpest virus P protein, in which three serine residues have been mutated, has been shown earlier to be non-functional in an in vivo minigenome replication/transcription system. In this work, we have shown that the phosphorylation of P protein is essential for transcription, whereas the null mutant is active in replication of the genome in vivo. The null mutant P acts as a transdominant repressor of transcriptional activity of wild-type P and as an activator of replication carried out by wild-type P protein. These results suggest the phosphorylation status of P may act as a replication switch during virus replication. We also show that the phosphorylation null mutant P is capable of interacting with L and N proteins and is able to form a tripartite complex of L-(N-P) when expressed in insect cells, similar to wild-type P protein.
Resumo:
An enzyme system which converts anthranilic acid to catechol was detected in the leaves of Tecoma stans, and its properties studied. The system is present exclusively in the chloroplast fraction of the leaves. The optimum pH of the reaction is 5·2 and maximum activity was obtained with citrate-phosphate buffer. There was good stoichiometry between the amounts of anthranilic acid disappeared and the amounts of catechol and ammonia formed. The enzyme system showed an absolute requirement for oxygen and evidence was obtained for the probable participation of NADPH and FAD in the hydroxylation step. The optimum concentration of anthranilic acid was 10−4 M; at higher concentrations the reaction was inhibited to a considerable extent. Cyanide, pyrophosphate, and EDTA also caused inhibition indicating a requirement for metal ions.