Cinnamate toxicity expression on phenylalanine ammonia-lyase activity, germination and growth of cucumber (Cucumis sativis) seedlings

Cinnamate is the product of phenylalanine ammonialyase (PAL). This compound, a precursor of phenolics in plants, has been shown to be phytotoxic. Cinnamate inhibits PAL activity in cucumber seedlings. DL-phenylalanine has the same effect on the enzyme but does not affect growth. Actinomycin D and cycloheximide are phytotoxic and inhibit PAL. Production of a double-peg has been noticed in the seedlings, grown in the presence of actinomycin D. Light stimulates PAL activity in the seedling.

Modulation of arginine decarboxylase activity in cucumber (Cucumis sativus) cotyledons in short-term organ culture

Among the various amines administered to excisedCucumis sativus cotyledons in short-term organ culture, agmatine (AGM) inhibited arginine decarboxylase (ADC) activity to around 50%, and putrescine was the most potent entity in this regard. Homoarginine (HARG) dramatically stimulated (3- to 4-fold) the enzyme activity. Both AGM inhibition and HARG stimulation of ADC were transient, the maximum response being elicited at 12 h of culture. Mixing experiments ruled out involvement of a macromolecular effector in the observed modulation of ADC. HARG-stimulated ADC activity was completely abolished by cycloheximide, whereas AGM-mediated inhibition was unaffected. Half-life of the enzyme did not alter on treatment with either HARG or AGM. The observed alterations in ADC activity are accompanied by change in Km of the enzyme. HARG-stimulated ADC activity is additive to that induced by benzyladenine (BA) whereas in presence of KCl, HARG failed to enhance ADC activity, thus demonstrating the overriding influence of K+ on amine metabolism.

Baker's yeast expressing the Japanese encephalitis virus envelope protein on its cell surface: induction of an antigen-specific but non-neutralizing antibody response

Live recombinant Saccharomyces cerevisiae yeast expressing the envelope antigen of Japanese encephalitis virus (JEV) on the outer mannoprotein layer of the cell wall were examined for their ability to induce antigen-specific antibody responses in mice. When used as a modelantigen, parenteral immunization of mice with surface-expressing GFP yeast induced a strong anti-GFP antibody response in the absence of adjuvants. This antigen delivery approach was then used for a more stringent system, such as the envelope protein of JEV, which is a neurotropic virus requiring neutralizing antibodies for protection.Although 70% of cells were detected to express the total envelope protein on the surface by antibodies raised to the bacterially expressed protein, polyclonal anti-JEV antibodies failed to react with them. In marked contrast, yeast expressing the envelope fragments 238-398, 373-399 and 373-500 in front of a Gly-Ser linker were detected by anti-JEV antibodies as well as a monoclonal antibody but not by antibodies raised to the bacterially expressed protein. Immunization of mice with these surface-expressing recombinants resulted in a strong antibody response. However, the antibodies failed to neutralize the virus, although the fragments were selected based on neutralizing determinants.

Targeted delivery of hepatitis C virus-specific short hairpin RNA in mouse liver using Sendai virosomes

Internal ribosome entry site (IRES)-mediated translation of input viral RNA is the initial required step for the replication of the positive-stranded genome of hepatitis C virus (HCV). We have shown previously the importance of the GCAC sequence near the initiator AUG within the stem and loop IV (SLIV) region in mediating ribosome assembly on HCV RNA. Here, we demonstrate selective inhibition of HCV-IRES-mediated translation using short hairpin (sh)RNA targeting the same site within the HCV IRES. sh-SLIV showed significant inhibition of viral RNA replication in a human hepatocellular carcinoma (Huh7) cell line harbouring a HCV monocistronic replicon. More importantly, co-transfection of infectious HCV-H77s RNA and sh-SLIV in Huh7.5 cells successfully demonstrated a significant decrease in viral RNA in HCV cell culture. Additionally, we report, for the first time, the targeted delivery of sh-SLIV RNA into mice liver using Sendai virosomes and demonstrate selective inhibition of HCV-IRES-mediated translation. Results provide the proof of concept that Sendai virosomes could be used for the efficient delivery of shRNAs into liver tissue to block HCV replication.

Simian Virus 40 Small T Antigen Activates AMPK and Triggers Autophagy To Protect Cancer Cells from Nutrient Deprivation

As tumors grow larger, they often experience an insufficient supply of oxygen and nutrients. Hence, cancer cells must develop mechanisms to overcome these stresses. Using an in vitro transformation model where the presence of the simian virus 40 (SV40) small T (ST) antigen has been shown to be critical for tumorigenic transformation, we investigated whether the ST antigen has a role to play in regulating the energy homeostasis of cancer cells. We find that cells expressing the SV40 ST antigen (+ST cells) are more resistant to glucose deprivation-induced cell death than cells lacking the SV40 ST antigen (-ST cells). Mechanistically, we find that the ST antigen mediates this effect by activating a nutrient-sensing kinase, AMP-activated protein kinase (AMPK). The basal level of active, phosphorylated AMPK was higher in +ST cells than in -ST cells, and these levels increased further in response to glucose deprivation. Additionally, inhibition of AMPK in +ST cells increased the rate of cell death, while activation of AMPK in -ST cells decreased the rate of cell death, under conditions of glucose deprivation. We further show that AMPK mediates its effects, at least in part, by inhibiting mTOR (mammalian target of rapamycin), thereby shutting down protein translation. Finally, we show that +ST cells exhibit a higher percentage of autophagy than -ST cells upon glucose deprivation. Thus, we demonstrate a novel role for the SV40 ST antigen in cancers, where it functions to maintain energy homeostasis during glucose deprivation by activating AMPK, inhibiting mTOR, and inducing autophagy as an alternate energy source.

Effect of cupric-isonicotinic acid hydrazide complex on avian myeloblastosis virus reverse transcriptase and its associated enzyme activities

Cupric complex of isonicotinic acid hydrazide inhibits DNA synthesis by avian myloblastosis virus reverse transcriptase. This inhibition occurs in the presence of either ribonucleotide or deoxyribonucleotide templates. The inhibition of reverse transcriptase by cupric-INH complex is considerably reduced when stored or proteolytically cleaved enzyme was used in the reaction. The complex also inhibits the reverse transciptase-associated RNase H activity. The cupric-isonicotinic acid hydrazide complex cleaves pBR 322 from I DNA into smaller molecules in the presence or absence of reverse transcriptase-associated endonuclease. However, in the presence of the enzyme the DNA is cleaved to a greater extent.

Molecular mechanism for the specific inhibition of reverse transcriptase of rous sarcoma virus by the copper complexes of isonicotinic acid hydrazide

Isonicotinic acid hydrazide (isoniazid), one of the most potent antitubercular drugs, was recently shown, in our laboratory, to form two different complexes with copper, depending upon the oxidation state of the metal ion. Both the complexes have been shown to possess antiviral activity against Rous sarcoma virus, an RNA tumor virus. The antiviral activity of the complexes has been attributed to their ability to inhibit the endogenous reverse transcriptase activity of RSV. More recent studies in our laboratory indicate that both these complexes inhibit both endogenous and exogenous reactions. As low a final concentration as 50 μM of the cupric and the cuprous complexes inhibits the endogenous reaction to the extent of 93 and 75 per cent respectively. Inhibition of the exogenous reaction varies with the templates. The inhibition can be reversed by either β-mercaptoethanol or ethylene-diamine-tetra-acetic acid. The specificity of this inhibition has been ascertained by using a synthetic primer-template, −(dG)not, vert, similar15−(rCm)n, which is highly specific for reverse transcriptases. The inhibition is found to be template specific. The studies carried out, using various synthetic primer-templates, show the inhibition of both the steps of reverse transcription by the copper complexes of isoniazid.

Nucleotide sequence of the 3' terminal region of belladonna mottle virus-Iowa (renamed Physalis mottle virus) RNA and an analysis of the relationships of tymoviral coat proteins

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Assembly of physalis mottle virus capsid protein in Escherichia coli and the role of amino and carboxy termini in the formation of the icosahedral particles

The coat protein gene of physalis mottle tymovirus (PhMV) was over expressed in Escherichia coli using pET-3d vector. The recombinant protein was found to self assemble into capsids in vivo. The purified recombinant capsids had an apparent s value of 56.5 S and a diameter of 29(±2) nm. In order to establish the role of amino and carboxy-terminal regions in capsid assembly, two amino-terminal deletions clones lacking the first 11 and 26 amino acid residues and two carboxy-terminal deletions lacking the last five and ten amino acid residues were constructed and overexpressed. The proteins lacking N-terminal 11 (PhCPN1) and 26 (PhCPN2) amino acid residues self assembled into T = 3 capsids in vivo, as evident from electron microscopy, ultracentrifugation and agarose gel electrophoresis. The recombinant, PhCPN1 and PhCPN2 capsids were as stable as the empty capsids formed in vivo and encapsidated a small amount of mRNA. The monoclonal antibody PA3B2, which recognizes the epitope within region 22 to 36, failed to react with PhCPN2 capsids while it recognized the recombinant and PhCPN1 capsids. Disassembly of the capsids upon treatment with urea showed that PhCPN2 capsids were most stable. These results demonstrate that the N-terminal 26 amino acid residues are not essential for T = 3 capsid assembly in PhMV. In contrast, both the proteins lacking the C-terminal five and ten amino acid residues were present only in the insoluble fraction and could not assemble into capsids, suggesting that these residues are crucial for folding and assembly of the particles.

Inhibition of replication of rinderpest virus by 5-fluorouracil

5-Fluorouracil (5FU), an analogue of uracil, was found to inhibit the production of infectious particles of rinderpest virus (RPV) in Vero cells (African green monkey kidney cells) by 99%, at a concentration of 1 μg/ml. The levels of individual mRNA specific for five of the virus genes were also reduced drastically, while the level of mRNA for a cellular housekeeping gene—glyceraldehyde-3-phosphate dehydrogenase (GAPDH)—was unaltered by fluorouracil treatment of infected cells. Both virus RNA and protein synthesis showed inhibition in a dose-dependent manner. The virions which budded out of 5-fluorouracil-treated cells also contained reduced amounts of virus proteins compared with virus particles from untreated cells.

Light- and cytokinin-induced changes in the levels of leucine and tyrosine isoaccepting tRNA species and modified nucleotide contents of total tRNA in cucumber seedlings

We have determined relative levels of chloroplast leucine and tyrosine isoaccepting tRNAs and modified nucleotide contents from total tRNAs isolated from dark-grown, light-grown, N6-isopentenyladenine (i6A)-treated dark-grown and i6A-treated light-grown cucumber seedlings. Significant increases in the relative amounts of tRNA(Leu)2 and tRNA(Leu)3 were observed in the i6A-treated dark-grown seedlings compared to dark-grown, light-grown and i6A-treated light-grown seedlings. On the other hand, i6A-treated light-grown seedlings tRNA(Tyr)1 increased to 85% of total tRNAs(Tyr) from about 9% in light-grown seedlings and tRNA(Tyr)2 decreased to 15% compared with 91% in light-grown seedlings. Analysis of modified nucleotide of total tRNAs indicated that pT, pI, pm1A, pm5C, pGm, pm1G, pm2G and pm7G contents were significantly higher in the total tRNA of i6A-treated dark-grown seedlings than those from untreated dark-grown seedlings. Illumination of 8-day-old dark-grown seedlings for 12 h increased the contents of pT, pI, pGm and pm1G when compared to 8-day-old dark-grown seedlings with extended growth for 12 h in dark. On the contrary, i6A had no stimulatory effect in the contents of modified nucleotide in the light-grown seedlings.

Characterization of a local isolate of Bombyx mori nuclear polyhedrosis virus

Polyhedral bodies of Bombyx mori nuclear polyhedrosis virus, BmNPV (BGL) isolated from infected silkworms around Bangalore were propagated either in the cultured B. mori cell line, BmN or through infection of larvae. Electron microscopic (EM) observations of the polyhedra revealed an average length of 2 mu m and a height of 0.5 mu m. The purified polyhedra derived virions (PDV) showed several bands in sucrose gradient centrifugation, indicating the multiple nucleocapsid nature of BmNPV. Electron microscopic studies of PDV revealed a cylindrical, rod-shaped nucleocapsid with an average length of 300 nm and a diameter of 35 nm. The genomic DNA from the PDV was characterized by extensive restriction analysis and the genome size was estimated to be 132 kb. The restriction pattern of BmNPV (BGL) resembled that of the prototype strain BmNPV-T3. Distinct differences due to polymorphic sites for restriction enzyme HindIII were apparent between BmNPV (BGL) and the virus isolated from a different part of Karnataka (Dharwad area), BmNPV (DHR).

Expression of Human Growth Hormone in Silkworm Larvae through RecombinantBombyx moriNuclear Polyhedrosis Virus

We have generated a recombinantBombyx morinuclear polyhedrosis virus, vBmhGH, harboring the full-length human growth hormone gene (2.4-kb genomic DNA, with four introns and the signal peptide sequences) under the control of the polyhedrin promoter. BmN cells in culture infected with the recombinant virus showed the presence of RNA corresponding to the authentic growth hormone mRNA as well as its incompletly processed precusor. Electrophoretic analysis and immunoprecipitation of proteins of recombinant virus-infected BmN cells revealed the presence of the growth hormone protein. Infection of silkworm larvae with vBmhGH led to the synthesis and efficient secretion of the protein into hemolymph. The recombinant human growth hormone was biologically active in a radioreceptor competition binding assay. The secreted protein was isolated and purified to homogeneity by a single step immunoaffinity chromatography, to a specific activity of 2.4 × 104U/mg. The recombinant hGH retained the immunological and biolological properties of the native peptide. We conclude that BmNPV vectors can be used successfully for expressing chromosomal genes harboring multiple introns.

Absence of parallelism between polyamine and nucleic acid contents during induced growth of cucumber cotyledons

The cytokinins (benzyladenine or benzyladenosine) decreased spermidine and spermine contents despite increasing putrescine content, when administered to isolated cotyledons of Cucumis sativus L. var. Guntur in organ culture. KCl decreased putrescine contents, although marginally increasing polyamine contents. The cytokinins and/or KCl augmented nucleic acid biosynthesis and accumulation, resulting in enhanced growth and differentiation of the isolated cotyledons. These observations show that polyamine accumulation and growth are not always coupled.