Description of plant tRNA-derived RNA fragments (tRFs) associated with argonaute and identification of their putative targets

tRNA-derived RNA fragments (tRFs) are 19mer small RNAs that associate with Argonaute (AGO) proteins in humans. However, in plants, it is unknown if tRFs bind with AGO proteins. Here, using public deep sequencing libraries of immunoprecipitated Argonaute proteins (AGO-IP) and bioinformatics approaches, we identified the Arabidopsis thaliana AGO-IP tRFs. Moreover, using three degradome deep sequencing libraries, we identified four putative tRF targets. The expression pattern of tRFs, based on deep sequencing data, was also analyzed under abiotic and biotic stresses. The results obtained here represent a useful starting point for future studies on tRFs in plants. © 2013 Loss-Morais et al.; licensee BioMed Central Ltd.

The complete mitochondrial genome of the yellow coaster, Acraea issoria (Lepidoptera: Nymphalidae: Heliconiinae: Acraeini): sequence, gene organization and a unique tRNA translocation event

In this paper, the complete mitochondrial genome of Acraea issoria (Lepidoptera: Nymphalidae: Heliconiinae: Acraeini) is reported; a circular molecule of 15,245 bp in size. For A. issoria, genes are arranged in the same order and orientation as the complete sequenced mitochondrial genomes of the other lepidopteran species, except for the presence of an extra copy of tRNAIle(AUR)b in the control region. All protein-coding genes of A. issoria mitogenome start with a typical ATN codon and terminate in the common stop codon TAA, except that COI gene uses TTG as its initial codon and terminates in a single T residue. All tRNA genes possess the typical clover leaf secondary structure except for tRNASer(AGN), which has a simple loop with the absence of the DHU stem. The sequence, organization and other features including nucleotide composition and codon usage of this mitochondrial genome were also reported and compared with those of other sequenced lepidopterans mitochondrial genomes. There are some short microsatellite-like repeat regions (e.g., (TA)9, polyA and polyT) scattered in the control region, however, the conspicuous macro-repeats units commonly found in other insect species are absent.

Characterization of 67 mitochondrial tRNA gene rearrangements in the Hymenoptera suggests that mitochondrial tRNA gene position is selectively neutral

We present entire sequences of two hymenopteran mitochondrial genomes and the major portion of three others. We combined these data with nine previously sequenced hymenopteran mitochondrial genomes. This allowed us to infer and analyze the evolution of the 67 mitochondrial gene rearrangements so far found in this order. All of these involve tRNA genes, whereas four also involve larger (protein-coding or ribosomal RNA) genes. We find that the vast majority of mitochondrial gene rearrangements are independently derived. A maximum of four of these rearrangements represent shared, derived organizations, whereas three are convergently derived. The remaining mitochondrial gene rearrangements represent new mitochondrial genome organizations. These data are consistent with the proposal that there are an enormous number of alternative mitochondrial genome organizations possible and that mitochondrial genome organization is, for the most part, selectively neutral. Nevertheless, some mitochondrial genes appear less mobile than others. Genes close to the noncoding region are generally more mobile but only marginally so. Some mitochondrial genes rearrange in a pattern consistent with the duplication/random loss model, but more mitochondrial genes move in a pattern inconsistent with this model. An increased rate of mitochondrial gene rearrangement is not tightly associated with the evolution of parasitism. Although parasitic lineages tend to have more mitochondrial gene rearrangements than nonparasitic lineages, there are exceptions (e.g., Orussus and Schlettererius). It is likely that only a small proportion of the total number of mitochondrial gene rearrangements that have occurred during the evolution of the Hymenoptera have been sampled in the present study.

Role of TATATAA element in the regulation of tRNA(1)(Gly) gene expression in Bombyx mori is position dependent

Transcription of tRNA genes by RNA polymerase III is controlled by the internal conserved sequences within the coding region and the immediate upstream flanking sequences. A highly transcribed copy of glycyl tRNA gene tRNA1(Gly)-1 from Bombyx mori is down regulated by sequences located much farther upstream in the region -150 to -300 nucleotides (nt), with respect to the +1 nt of tRNA. The negative regulatory effect has been narrowed down to a sequence motif 'TATATAA', a perfect consensus recognised by the TATA binding protein, TBP. This sequence element, when brought closer to the transcription start point, on the other hand, exerts a positive effect by promoting transcription of the gene devoid of other cis regulatory elements. The identity of the nuclear protein interacting with this 'TATATAA' element to TBP has been established by antibody and mutagenesis studies. The 'TATATAA' element thus influences the transcription of tRNA genes positively or negatively in a position-dependent manner either by recruitment or sequestration of TBP from the transcription machinery.

Allostery in tRNA Synthetases Elucidated from MD Simulations and Protein Structure Networks

tRNA synthetases (aaRS) are enzymes crucial in the translation of genetic code. The enzyme accylates the acceptor stem of tRNA by the congnate amino acid bound at the active site, when the anti-codon is recognized by the anti-codon site of aaRS. In a typical aaRS, the distance between the anti-codon region and the amino accylation site is approximately 70 Å. We have investigated this allosteric phenomenon at molecular level by MD simulations followed by the analysis of protein structure networks (PSN) of non-covalent interactions. Specifically, we have generated conformational ensembles by performing MD simulations on different liganded states of methionyl tRNA synthetase (MetRS) from Escherichia coli and tryptophenyl tRNA synthetase (TrpRS) from Human. The correlated residues during the MD simulations are identified by cross correlation maps. We have identified the amino acids connecting the correlated residues by the shortest path between the two selected members of the PSN. The frequencies of paths have been evaluated from the MD snapshots[1]. The conformational populations in different liganded states of the protein have been beautifully captured in terms of network parameters such as hubs, cliques and communities[2]. These parameters have been associated with the rigidity and plasticity of the protein conformations and can be associated with free energy landscape. A comparison of allosteric communication in MetRS and TrpRS [3] elucidated in this study highlights diverse means adopted by different enzymes to perform a similar function. The computational method described for these two enzymes can be applied to the investigation of allostery in other systems.

Ammonium ions prevent methylation of uridine to ribothymidine in Azotobacter vinelandii tRNA

It was shown that tRNA from Azotobacter vinelandii grown in the presence of ammonium chloride lacks ribothymidine while that grown in the absence of the ammonium salt contains this modified nucleoside. [32P]-Labelled tRNA from this organism grown in a medium containing the ammonium salt was digested with RNase T1 and the pseudouridinecontaining tetranucleotide, common to all tRNAs was isolated and analysed for the nucleoside replacing the ribothymidine. It was found to be uridine. Cells previously labelled with [32P]- phosphate in the ammonium salt medium were washed and incubated in the ammonium saltfree medium to test whether ribothymidine would be formed upon removal of the ammoniumions. Methylation of the uridine did not take place.

A rapid and sensitive method for the estimation of individual tRNA pools

A rapid and sensitive method is described to quantitatively compare tRNA pools for individual aminoacids in a single experiment. The procedure comprises of: (i) charging of total tRNA with a mixture of radiolabeled aminoacids, (ii) deacylation of the esterified tRNA with a volatile base and the recovery of the labeled aminoacid, (iii) derivatisation of the aminoacid with phenylisothiocyanate after mixing with excess of nonradioactive aminoacids, (iv) baseline separation of the phenylthiocarbamyl aminoacids by reverse phase high performance liquid chromatography monitored by A254nm and (v) quantitation of the radioactivity in individual aminoacid peaks. The radioactivity in the aminoacid peak corresponds to the quantity of the aminoacylated tRNA. The method has been successfully applied to quantitate the individual tRNA pools in the developing silk glands of Bombyx mori, a functionally adapted tissue which undergoes considerable variations in tRNA content. PSG, posterior silk gland; PITC, phenylisothiocyanate; DMAA, N,N-dimethyl-N-allylamine; APH, algal protein hydrolysate; ptc-, phenylthiocarbamyl; HPLC, high performance liquid chromatography.

5-Methyl-2-Thiouridine in the tRNA of Candida tropicalis and Its Localization in Lysine tRNA

35S incorporation studies showed that Candida tropicalis tRNA contained two thionucleosides, one of which was identified as 5-methyl-2-thiouridine. The other thionucleoside was alkali labile, and it appeared to be an ester. Pulse-chase experiments suggested that the two thionucleosides were structurally related. 5-Methyl-2-thiouridine was present in one of the lysine tRNAs. This is the first report of the presence of this nucleoside in a yeast tRNA.

2-O-methyl-1-methyl adenosine: A new modified nucleoside in ragi (eleusine coracana ) tRNA

A new modified nucleoside 2-²-O-methyl-l-methyl adenosine has been found to be present in the tRNA of (eleusine coracana ) (ragi) seedlings. The sequence of the dinucleotide of which this modified nucleoside is a part suggests its presence in phenylalanine-tRNA. The structural implications of the presence of this new modification are discussed.

Presence of 2-methylthioribosyl-trans-zeatin in Azotobacter vinelandii tRNA.

Hydroxylated cytokinin, 2-methylthio-N6-(4-hydroxy-3-methylbut-2-enyl) adenosine, was found in the tRNA of Azotobacter vinelandii. This cytokinin had the trans configuration, unlike the cis configuration reported for that from other bacteria. Culture-condition-dependent changes in the content of this thiocytokinin and a few other thionucleosides in the tRNA of this bacterium have been observed.

Nucleotide sequence of initiator tRNA from Mycobacterium smegmatis

Abstract is not available.

Mechanism of aminoacylation of tRNA : Influence of spermine on the kinetics of aminoacyl-tRNA synthesis by isoleucyl- and valyl-tRNA synthetases from Mycobacterium smegmatis

Isoleucyl-tRNA synthetase has been purified to homogeneity from Mycobacterium smegmatis. The influence of spermine on the kinetics of valyl-tRNA and isoleucyl-tRNA formation has been investigated by Cleland's method (Cleland, W.W. (1963) Biochim. Biophys. Acta 67, 104–137, 173–187, 188–196). The results suggest that in the presence of spermine and suboptimal concentration of Mg2+, the formation of valyl-tRNA and isoleucyl-tRNA follows a sequential* mechanism. In the presence of an optimal concentration of Mg2+, both valyl-tRNA and isoleucyl-tRNA formation proceeds by a ping-pong mechanism. However, in the presence of spermine and optimal concentrations of Mg2+, valyl-tRNA formation follows the ping-pong mechanism while isoleucyl-tRNA formation follows the sequential mechanism.

A simple method for large-scale preparation of chick embryo tRNA

A simple method for preparing bulk quantities of tRNA from chick embryo has been developed. In this method chick embryos were homogenized in a buffer of pH 4.5, followed by deproteinization with phenol. The aqueous layer was allowed to separate under gravity. The resulting aqueous layer, after two more phenol treatments, was directly passed through a DEAE-cellulose column and the tRNA eluted therefrom with 1 Image NaCl. The tRNA prepared by this method was as active as the one prepared at neutral pH.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.