831 resultados para progeny testing


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Genetic gains predicted for selection, based on both individual performance and progeny testing, were compared to provide information to be used in implementation of progeny testing for a Nelore cattle breeding program. The prediction of genetic gain based on progeny testing was obtained from a formula, derived from methodology of Young and weller (J. Genetics 57: 329-338, 1960) for two-stage selection, which allows prediction of genetic gain per generation when the individuals under test have been pre-selected on the basis of their own performance. The application of this formula also allowed determination of the number of progeny per tested bull needed to maximize genetic gain, when the total number of tested progeny is limited.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Genetic gains predicted for selection, based on both individual performance and progeny testing, were compared to provide information to be used in implementation of progeny testing for a Nelore cattle breeding program. The prediction of genetic gain based on progeny testing was obtained from a formula, derived from methodology of Young and Weiler (J. Genetics 57: 329-338, 1960) for two-stage selection, which allows prediction of genetic gain per generation when the individuals under test have been pre-selected on the basis of their own performance. The application of this formula also allowed determination of the number of progeny per tested bull needed to maximize genetic gain, when the total number of tested progeny is limited.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Botutatu is a new released peanut cultivar, selected from the Brazilian cultivar Tatu by progeny testing. It belongs to Valencia type and has similar characteristics of cultivar Tatu, differing from the late by being 23.7% superior in pod yield.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Genetic analyses of sex determination have identified sex chromosomes in many teleost fish species. However, there are several cases for which sex ratios do not fit perfectly with the expectations of heterogametic systems, suggesting the influence of either minor sex determining genes or environmental influences on the process of sex differentiation. The frequent absence of sex chromosome markers makes the identification of minor sex-determining genes very difficult. It is easier to test first the hypothesis of environmental sex determination (ESD) by studying the temperature effect, since temperature-dependent sex determination has been demonstrated to occur in several vertebrate groups including 1 fish species. To contribute to a better understanding of fish sex determination, we have tested the effects of high temperatures on sex ratios of Oreochromis niloticus, and have attempted to isolate sex chromosome molecular markers in Leporinus elongatus. Treatments of O. niloticus fry at 36 degrees C applied for 10 days and more, and starting 1 week after fertilization markedly increased the proportion of males, and progeny-testing these males confirmed that some of them are sex-reversed genetic females. Two non-coding sequences of L. elongatus Z and W chromosomes were cloned by genomic subtraction. They cross-hybridized with the genome of a close species without providing sex-specific patterns. A collection of L. elongates individuals was subjected to gonadal and chromosomal sexing, and DNA hybridization with both sequences. These analyses revealed 3 individuals having atypical W chromosomes. Interestingly, 2 of these were males having a ZW karyotype. We assume that these atypical sex chromosome arise by exchanges between Z and W chromosomes, and that a transition between female and male heterogamety is underway in this species.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The breeding program for beef cattle in Japan has changed dramatically over 4 decades. Visual judging was done initially, but progeny testing in test stations began in 1968. In the 1980s, the genetic evaluation program using field records, so-called on-farm progeny testing, was first adopted in Oita, Hyogo, and Kumamoto prefectures. In this study, genetic trends for carcass traits in these 3 Wagyu populations were estimated, and genetic gains per year were compared among the 3 different beef cattle breeding programs. The field carcass records used were collected between 1988 and 2003. The traits analyzed were carcass weight, LM area, rib thickness, s.c. fat thickness, and beef marbling standard number. The average breeding values of reproducing dams born the same year were used to estimate the genetic trends for the carcass traits. For comparison of the 3 breeding programs, birth years of the dams were divided into 3 periods reflecting each program. Positive genetic trends for beef marbling standard number were clearly shown in all populations. The genetic gains per year for all carcass traits were significantly enhanced by adopting the on-farm progeny testing program. These results indicate that the on-farm progeny testing program with BLUP is a very powerful approach for genetic improvement of carcass traits in Japanese Wagyu beef cattle.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Predicting progeny performance from parental genetic divergence can potentially enhance the efficiency of supportive breeding programmes and facilitate risk assessment. Yet, experimental testing of the effects of breeding distance on offspring performance remains rare, especially in wild populations of vertebrates. Recent studies have demonstrated that embryos of salmonid fish are sensitive indicators of additive genetic variance for viability traits. We therefore used gametes of wild brown trout (Salmo trutta) from five genetically distinct populations of a river catchment in Switzerland, and used a full factorial design to produce over 2,000 embryos in 100 different crosses with varying genetic distances (FST range 0.005-0.035). Customized egg capsules allowed recording the survival of individual embryos until hatching under natural field conditions. Our breeding design enabled us to evaluate the role of the environment, of genetic and nongenetic parental contributions, and of interactions between these factors, on embryo viability. We found that embryo survival was strongly affected by maternal environmental (i.e. non-genetic) effects and by the microenvironment, i.e. by the location within the gravel. However, embryo survival was not predicted by population divergence, parental allelic dissimilarity, or heterozygosity, neither in the field nor under laboratory conditions. Our findings suggest that the genetic effects of inter-population hybridization within a genetically differentiated meta-population can be minor in comparison to environmental effects.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A manufactured product (Ectoplus®) composed by a cypermethrin (44.7%) and dichlorvos (4.2%) mixture was administered (10mg/kg/day, orally, by gavage) to pregnant rats, during the periods of gestation+lactation, gestation, and lactation. Control mothers received vehicle aqueous solution during the gestation+lactation period. With the progeny, in the 1-15 post-natal days (PNDI-15) there were observed alterations in the periods of occurrence of teeth, hair, unfolding of ears, and in the developmental period for following reflexes: postural, palmar grasp, negative geotaxis, and acoustic startle reflex. After weaning (PND21), there were observed the presence of cypermethrin and dichlorvos in the blood brain and liver; decrease in weight of liver, of cholinesterase activity in the plasma, liver, and brain, and hepatic metabolizing activity of drugs; alterations of levels of gamma glutamyl transferase enzymes, of creatinine, and of potassium in the serum of the animals. In conclusion, neonatal exposure to a formulated mixture of cypermethrin and dichlorvos is inductive to alterations in characteristics that indicate somatic and neuromuscular development of the progeny, and in certain biochemical parameters. The results suggest that enzymatic assessment associated with somatic and neuromotor assessment can be important markers of developmental characteristics in neonatal toxicity by pesticide formulations based on mixtures of insecticides.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In about 50% of first trimester spontaneous abortion the cause remains undetermined after standard cytogenetic investigation. We evaluated the usefulness of array-CGH in diagnosing chromosome abnormalities in products of conception from first trimester spontaneous abortions. Cell culture was carried out in short- and long-term cultures of 54 specimens and cytogenetic analysis was successful in 49 of them. Cytogenetic abnormalities (numerical and structural) were detected in 22 (44.89%) specimens. Subsequent, array-CGH based on large insert clones spaced at ~1 Mb intervals over the whole genome was used in 17 cases with normal G-banding karyotype. This revealed chromosome aneuplodies in three additional cases, giving a final total of 51% cases in which an abnormal karyotype was detected. In keeping with other recently published works, this study shows that array-CGH detects abnormalities in a further ~10% of spontaneous abortion specimens considered to be normal using standard cytogenetic methods. As such, array-CGH technique may present a suitable complementary test to cytogenetic analysis in cases with a normal karyotype.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to test the hypothesis of differences in performance including differences in ST-T wave changes between healthy men and women submitted to an exercise stress test. Two hundred (45.4%) men and 241 (54.6%) women (mean age: 38.7 ± 11.0 years) were submitted to an exercise stress test. Physiologic and electrocardiographic variables were compared by the Student t-test and the chi-square test. To test the hypothesis of differences in ST-segment changes, data were ranked with functional models based on weighted least squares. To evaluate the influence of gender and age on the diagnosis of ST-segment abnormality, a logistic model was adjusted; P < 0.05 was considered to be significant. Rate-pressure product, duration of exercise and estimated functional capacity were higher in men (P < 0.05). Sixteen (6.7%) women and 9 (4.5%) men demonstrated ST-segment upslope ≥0.15 mV or downslope ≥0.10 mV; the difference was not statistically significant. Age increase of one year added 4% to the chance of upsloping of segment ST ≥0.15 mV or downsloping of segment ST ≥0.1 mV (P = 0.03; risk ratio = 1.040, 95% confidence interval (CI) = 1.002-1.080). Heart rate recovery was higher in women (P < 0.05). The chance of women showing an increase of systolic blood pressure ≤30 mmHg was 85% higher (P = 0.01; risk ratio = 1.85, 95%CI = 1.1-3.05). No significant difference in the frequency of ST-T wave changes was observed between men and women. Other differences may be related to different physical conditioning.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The network of HIV counseling and testing centers in São Paulo, Brazil is a major source of data used to build epidemiological profiles of the client population. We examined HIV-1 incidence from November 2000 to April 2001, comparing epidemiological and socio-behavioral data of recently-infected individuals with those with long-standing infection. A less sensitive ELISA was employed to identify recent infection. The overall incidence of HIV-1 infection was 0.53/100/year (95% CI: 0.31-0.85/100/year): 0.77/100/year for males (95% CI: 0.42-1.27/100/year) and 0.22/100/ year (95% CI: 0.05-0.59/100/year) for females. Overall HIV-1 prevalence was 3.2% (95% CI: 2.8-3.7%), being 4.0% among males (95% CI: 3.3-4.7%) and 2.1% among females (95% CI: 1.6-2.8%). Recent infections accounted for 15% of the total (95% CI: 10.2-20.8%). Recent infection correlated with being younger and male (p = 0.019). Therefore, recent infection was more common among younger males and older females.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Rotational osteotomy is frequently indicated to correct excessive femoral anteversion in cerebral palsy patients. Angled blade plate is the standard fixation device used when performed in the proximal femur, but extensile exposure is required for plate accommodation. The authors developed a short locked intramedullary nail to be applied percutaneously in the fixation of femoral rotational osteotomies in children with cerebral palsy and evaluated its mechanical properties. Methods: The study was divided into three stages. In the first part, a prototype was designed and made based on radiographic measurements of the femoral medullary canal of ten-year-old patients. In the second, synthetic femoral models based on rapid-prototyping of 3D reconstructed images of patients with cerebral palsy were obtained and were employed to adjust the nail prototype to the morphological changes observed in this disease. In the third, rotational osteotomies were simulated using synthetic femoral models stabilized by the nail and by the AO-ASIF fixed-angle blade plate. Mechanical testing was done comparing both devices in bending-compression and torsion. Results: The authors observed proper adaptation of the nail to normal and morphologically altered femoral models, and during the simulated osteotomies. Stiffness in bending-compression was significantly higher in the group fixed by the plate (388.97 +/- 57.25 N/mm) than in that fixed by the nail (268.26 +/- 38.51 N/mm) as torsional relative stiffness was significantly higher in the group fixed by the plate (1.07 +/- 0.36 Nm/degrees) than by the nail (0.35 +/- 0.13 Nm/degrees). Conclusions: Although the device presented adequate design and dimension to fit into the pediatric femur, mechanical tests indicated that the nail was less stable than the blade plate in bending-compression and torsion. This may be a beneficial property, and it can be attributed to the more flexible fixation found in intramedullary devices.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this Letter, we propose a new and model-independent cosmological test for the distance-duality (DD) relation, eta = D(L)(z)(1 + z)(-2)/D(A)(z) = 1, where D(L) and D(A) are, respectively, the luminosity and angular diameter distances. For D(L) we consider two sub-samples of Type Ia supernovae (SNe Ia) taken from Constitution data whereas D(A) distances are provided by two samples of galaxy clusters compiled by De Filippis et al. and Bonamente et al. by combining Sunyaev-Zeldovich effect and X-ray surface brightness. The SNe Ia redshifts of each sub-sample were carefully chosen to coincide with the ones of the associated galaxy cluster sample (Delta z < 0.005), thereby allowing a direct test of the DD relation. Since for very low redshifts, D(A)(z) approximate to D(L)(z), we have tested the DD relation by assuming that. is a function of the redshift parameterized by two different expressions: eta(z) = 1 + eta(0)z and eta(z) = 1 +eta(0)z/(1 + z), where eta(0) is a constant parameter quantifying a possible departure from the strict validity of the reciprocity relation (eta(0) = 0). In the best scenario (linear parameterization), we obtain eta(0) = -0.28(-0.44)(+0.44) (2 sigma, statistical + systematic errors) for the De Filippis et al. sample (elliptical geometry), a result only marginally compatible with the DD relation. However, for the Bonamente et al. sample (spherical geometry) the constraint is eta(0) = -0.42(-0.34)(+0.34) (3 sigma, statistical + systematic errors), which is clearly incompatible with the duality-distance relation.