Evaluation of noise levels experienced by medically fragile neonates during emergency helicopter transport

There was a concern medically fragile infants may be exposed to high noise levels during emergency helicopter transport. This study had been initiated in 2007. Data was collected using a Larson Davis noise dosimeter. The purpose of this study was to collect additional data to evaluate the noise exposure experienced by medically fragile neonates during emergency transport via helicopter inbound/outbound of St. Louis Children’s Hospital, St. Louis, MO. The results suggested neonates may be exposed to noise levels ranging 85 to 95 dBA during transport. These high noise exposures may pose a risk to hearing.

Children with special health care needs: Comparison of the effects of home care setting, prescribed pediatric extended care setting, and long-term care setting on child and family health outcomes and health care service use

Technological advances during the past 30 years have dramatically improved survival rates for children with life-threatening conditions (preterm births, congenital anomalies, disease, or injury) resulting in children with special health care needs (CSHCN), children who have or are at increased risk for a chronic physical, developmental, behavioral, or emotional condition and who require health and related services beyond that required by children generally. There are approximately 10.2 million of these children in the United States or one in five households with a child with special health care needs. Care for these children is limited to home care, medical day care (Prescribed Pediatric Extended Care; P-PEC) or a long term care (LTC) facility. There is very limited research examining health outcomes of CSHCN and their families. The purpose of this research was to compare the effects of home care settings, P-PEC settings, and LTC settings on child health and functioning, family health and function, and health care service use of families with CSHCN. Eighty four CSHCN ages 2 to 21 years having a medically fragile or complex medical condition that required continual monitoring were enrolled with their parents/guardians. Interviews were conducted monthly for five months using the PedsQL™ Generic Core Module for child health and functioning, PedsQL™ Family Impact Module for family health and functioning, and Access to Care from the NS-CSHCN survey for health care services. Descriptive statistics, chi square, and ANCOVA were conducted to determine differences across care settings. Children in the P-PEC settings had a highest health care quality of life (HRQL) overall including physical and psychosocial functioning. Parents/guardians with CSHCN in LTC had the highest HRQL including having time and energy for a social life and employment. Parents/guardians with CSHCN in home care settings had the poorest HRQL including physical and psychosocial functioning with cognitive difficulties, difficulties with worry, communication, and daily activities. They had the fewest hours of employment and the most hours providing direct care for their children. Overall health care service use was the same across the care settings.

Children with Special Health Care Needs: Comparison of the Effects of Home Care Setting, Prescribed Pediatric Extended Care Setting, and Long-Term Care Setting on Child and Family Health Outcomes and Health Care Service Use

Technological advances during the past 30 years have dramatically improved survival rates for children with life-threatening conditions (preterm births, congenital anomalies, disease, or injury) resulting in children with special health care needs (CSHCN), children who have or are at increased risk for a chronic physical, developmental, behavioral, or emotional condition and who require health and related services beyond that required by children generally. There are approximately 10.2 million of these children in the United States or one in five households with a child with special health care needs. Care for these children is limited to home care, medical day care (Prescribed Pediatric Extended Care; P-PEC) or a long term care (LTC) facility. There is very limited research examining health outcomes of CSHCN and their families. The purpose of this research was to compare the effects of home care settings, P-PEC settings, and LTC settings on child health and functioning, family health and function, and health care service use of families with CSHCN. Eighty four CSHCN ages 2 to 21 years having a medically fragile or complex medical condition that required continual monitoring were enrolled with their parents/guardians. Interviews were conducted monthly for five months using the PedsQL TM Generic Core Module for child health and functioning, PedsQL TM Family Impact Module for family health and functioning, and Access to Care from the NS-CSHCN survey for health care services. Descriptive statistics, chi square, and ANCOVA were conducted to determine differences across care settings. Children in the P-PEC settings had a highest health care quality of life (HRQL) overall including physical and psychosocial functioning. Parents/guardians with CSHCN in LTC had the highest HRQL including having time and energy for a social life and employment. Parents/guardians with CSHCN in home care settings had the poorest HRQL including physical and psychosocial functioning with cognitive difficulties, difficulties with worry, communication, and daily activities. They had the fewest hours of employment and the most hours providing direct care for their children. Overall health care service use was the same across the care settings.

FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Chromosomal fragile site FRA16D and DNA instability in cancer

It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not Set clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998), Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.

Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Folate-sensitive fragile site FRA10A is due to an expansion of a CGG repeat in a novel gene, FRA10AC1, encoding a nuclear protein

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Comparative role of neuropsychological testing in the presurgical evaluation of children with medically intractable epilepsies

In the present study, we evaluated the preoperative demographic, clinical, and neuropsychological variables that could predict postoperative seizure outcome in a group of pediatric epileptic patients. We studied 40 consecutive pediatric patients, ages ranging from 6 to 16 years, that underwent resective surgery for the treatment of medically intractable epilepsy at the Clinical Hospital of RibeirA o pound Preto School of Medicine. We performed ictal electroencephalography (EEG), interictal EEG, magnetic resonance imaging (MRI), and a preoperative neuropsychological assessment in the presurgical workup. The following factors were correlated with seizure outcome: (1) duration of epilepsy, (2) surgery localization, (3) localized Neuropsychological (NPS) Evaluation, (4) ictal EEG, (5) interictal EEG, and (6) MRI. Mental retardation, NPS tests, and the other demographic variables failed to correlate with seizure reduction. The identification of predictor variables of epilepsy surgery outcome could improve the epileptic prognosis and guarantee the children`s full potential development.