902 resultados para fluorescent brightening agents


Relevância:

100.00% 100.00%

Publicador:

Resumo:

This thesis investigates how the optical properties of paperboard influences printing with targets in ISO 12647-2. The targets for optical properties in ISO 12647-2 are defined for paperboard without optical brightening agents and fluorescent brightening agents wich makes it difficult to reach the targets when printing paperboard containing these agents.Seven different types of paperboard, some with and some without the agents, have been printed and instrumentally andvisually measured to see if there is any deviation from the standard targets and if it shows visually.The result shows that paperboard containing optical brightening agents and fluorescent brightening agents can print with targets in ISO 12647-2 but in many measurments the difference between the types of paperboard were to small to assess. The differences between the types of paperboard in the instrumental measurements did not fully correspond with the waythe panel appraised them visually.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Pyrazoline derivatives have been used widely in dyeing industry as fluorescent whitening agents due to their excellent capability. According to Schellhammer theory of the relation between chemical structure and fluorescent quality, six new fluorescent compounds were designed and synthesized which contained the benzothiazole group in the I-pyrazoline, the indole group in the 3-pyrazoline and the derivatives of phenyl in the 5-pyrazoline. The structure of target compounds was confirmed by IR, H-1 NMR, MS and elementary analysis. The fluorescence spectra showed that these compounds had good fluorescence. They could absorb ultraviolet light at near 353 nm. The fluorescence maximum emission wavelengths were about 430-443 nm. It was a kind of promising fluorescence compounds. The largest fluorescence emission wavelength and the fluorescence intensity were related to the substituted group of the compounds. When the 6-Br group was introduced into benzothiazole, the fluorescence emission wavelength exhibited a blue shift, and the fluorescence intensity increased.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We report the encapsulation of optical brightening agent (OBA) into hollow microcapsules prepared by the controlled Layer- by-Layer (LbL) self-assembly process, achieved by the sequential adsorption of oppositely charged polyelectrolytes using negatively charged silica template. Loading takes place by spontaneous deposition method which was proved by confocal laser scanning microscopy (CLSM) using rhodamine 6G (Rd6G) as a fluorescent probe. The loading of the OBA into the microcapsules was found to be dependent on the feeding concentration, pH of the medium, and loading temperature. The encapsulation efficiency of OBA decreased on increasing feeding concentration. Maximum loading was observed at pH 4 and amount of OBA loaded decreased with increase in pH. The loaded OBA was released in a sustained manner for 8 h. No degradation of the OBA was observed during the process of encapsulation and release. Polyelectrolyte capsules potentially offer an innovative way of encapsulating large amounts of active materials for a variety of applications. (c) 2012 Wiley Periodicals, Inc. J. Appl. Polym. Sci. 127: 1609-1614, 2013

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Le but de ce travail de mémoire était d'explorer des moyens pour augmenter la perméabilité des biofilms de Streptococcus mutans aux macromolécules en utilisant des agents potentiellement perturbateurs de la structure des biofilms. L’acide éthylènediamine tétraacétique (EDTA) ainsi que l’acide acétylsalicylique (aspirine) sont les agents perturbateurs choisis. Le changement de perméabilité des biofilms de S. mutans a été déterminé en mesurant les coefficients de diffusion globale du polyéthylène glycol (PEG) et de diffusion locale de dextrans. Les coefficients de diffusion globale ont été mesurés par spectroscopie infrarouge avec un échantillonnage par réflexion totale atténuée (ATR) alors que la spectroscopie par corrélation de fluorescence (SCF) a été utilisée pour la mesure des coefficients de diffusion locale. Les résultats ont démontré que l’incorporation de l’EDTA à une concentration de 7.5 (m/v) % dans la solution de diffusion permet d’améliorer les propriétés de transport du PEG dans les biofilms en augmentant sa pénétrabilité et son coefficient de diffusion globale. Par contre, aucune variation n’a été constatée dans la valeur du coefficient de diffusion locale de dextran fluorescent. Cette différence peut être expliquée, entre autres, par l'échelle des mesures et la nature différente des molécules diffusantes. L’aspirine n’a démontré aucun effet sur le transport du PEG à travers les biofilms de S. mutans. La pénétration accrue du PEG en présence de l’EDTA a été corrélée aux tests de viabilité des cellules bactériennes. En effet, la combinaison de la pénicilline G (PenG) avec l’EDTA 2 (m/v) % a eu comme effet l’augmentation du pouvoir biocide d’un facteur 3. De plus, les images de microscopie à épifluorescence et de microscopie confocale à balayage de laser ont démontré que les bactéries dans le cœur des microcolonies sont plus affectées par la PenG lorsque le milieu contient de l'EDTA. A la lumière des résultats obtenus, il s’avère que l’incorporation d'agents perturbateurs de la structure des biofilms est une option sérieuse à considérer dans l’éradication des biofilms microbiens. Plus d’études devront être effectuées afin d’investiguer l’effet d’autres molécules possédant les propriétés perturbatrices de la structure des biofilms sur la résistance de ces derniers aux agents antimicrobiens.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Multimodal imaging agents that combine magnetic and fluorescent imaging capabilities are desirable for the high spatial and temporal resolution. In the present work, we report the synthesis of multifunctional fluorescent ferrofluids using iron oxide as the magnetic core and rhodamine B as fluorochrome shell. The core–shell structure was designed in such a way that fluorescence quenching due to the inner magnetic core was minimized by an intermediate layer of silica. The intermediate passive layer of silica was realized by a novel method which involves the esterification reaction between the epoxy group of prehydrolysed 3-Glyidoxypropyltrimethoxysilane and the surfactant over iron oxide. The as-synthesized ferrofluids have a high saturation magnetization in the range of 62–65 emu/g and were found to emit light of wavelength 640 nm ( excitation = 446 nm). Time resolved life time decay analysis showed a bi-exponential decay pattern with an increase in the decay life time in the presence of intermediate silica layer. Cytotoxicity studies confirmed the cell viability of these materials. The in vitro MRI imaging illustrated a high contrast when these multimodal nano probes were employed and the R2 relaxivity of these ∗Author to whom correspondence should be addressed. Email: smissmis@gmail.com sample was found to be 334 mM−1s−1 which reveals its high potential as a T2 contrast enhancing agent

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Molts bacteris del grup fluorescent del gènere Pseudomonas són capaços de controlar malalties de les plantes causades per fongs i bacteris fitopatògens (ACBs) o mostren activitat com a bacteris promotors del creixement de les plantes (BPCPs). S'han descrit diversos metabòlits que intervenen de manera important en la seva activitat com a ACBs i BPCPs entre els quals en destaquen el 2,4-diacetilfloroglucinol (Phl), àcid fenazin-1-carboxílic (PCA), Pirrolnitrina (Prn), àcid cianhídric (HCN), àcid 3-indolacètic (IAA), sideròfors i quitinases. L'objectiu principal del nostre treball ha estat la comparació de les característiques d'un grup de Pseudomonas del grup fluorescent utilitzant una aproximació polifàsica amb la finalitat d'establir possibles relacions entre algunes de les característiques i la capacitat d'actuar com a ACB o BPCP. Atesa la importància en el biocontrol de la producció de metabòlits com Phl, PCA i Prn, l'objectiu preliminar ha estat la recerca i obtenció de soques productores d'aquests metabòlits. Per assolir aquest objectiu s'ha emprat una aproximació molecular basada en la detecció dels gens biosintètics implicats en la seva producció en lloc de la detecció directa dels metabòlits per evitar els efectes que poden tenir les condicions de cultiu en la inducció o repressió de la seva síntesi. S'han realitzat diferents protocols basats (i) en la cerca assistida de productors mitjançant l'ús de marcadors fenotípics i posterior confirmació per PCR i, (ii) en l'ús de la PCR per a la detecció dels gens directament dels extractes bacterians, d'enriquiments d'aquests extractes i la realització de la hibridació en colònies per al posterior aïllament. La cerca assistida de productors de Phl mitjançant marcadors fenotípics i posteriorment la utilització de tècniques moleculars (amplificació per PCR del gen phlD), ha estat el millor mètode en el tipus de mostres processades en el nostre treball, on la proporció de productors és relativament baixa. En total s'han aïllat a partir de diversos ambients 4 soques portadores dels gens de la síntesi de PCA, 15 de Phl i 1 de Prn. S'ha constituït una col·lecció de 72 soques de Pseudomonas del grup fluorescent que inclou 18 aïllats propis portadors dels gens biosintètics necessaris per la producció de Phl PCA i Prn; 6 soques de referència procedents de col·leccions de cultius tipus, 14 soques productores dels diferents antibiòtics cedides per altres investigadors i una selecció de 34 soques procedents d'un treball previ realitzat en el nostre grup de recerca. A la col·lecció s'hi troben soques candidates a ACB i BPCP de diverses malalties i plantes. Les 72 soques s'han caracteritzat fenotípica i genotípicament. La caracterització fenotípica s'ha portat a terme mitjançant la identificació a nivell d'espècie amb galeries API 20NE i proves bioquímiques específiques; la producció de metabòlits com PCA, Phl, Prn, IAA, HCN, quitinases i sideròfors mitjançant l'ús de diferents tècniques; antagonisme in vitro en diversos medis enfront dos fongs (Stemphylium vesicarium i Penicillium expansum) i tres bacteris fitopatògens (Erwinia amylovora, Pseudomonas syringae pv. syringae i Xanthomonas arboricola pv. juglandis); l'eficàcia de la inhibició de la infecció en bioassaigs in vivo sobre material vegetal enfront els fongs P. expansum en poma i S. vesicarium en fulles de perera i enfront el bacteri E. amylovora en fruits immadurs de perera i, finalment, en assaigs de promoció de creixement en dos portaempelts comercials de Prunus. Cal destacar que P. expansum causa la podridura blava en pomes i peres en postcollita, S. vesicarium la taca bruna de la perera i E. amylovora el foc bacterià de les rosàcies. El nombre de soques de Pseudomonas, sobre el total de les 72 estudiades, productores d'IAA (4) i quitinases (6) és baix, mentre que és elevat en el cas del HCN (32), que a més està associat a la producció de Phl. Els resultats obtinguts en l'antagonisme in vitro han mostrat en el cas dels bacteris que és dependent del patogen indicador i del medi de cultiu. La presència o absència de ferro no sembla ser un factor que potencií l'antagonisme. En el cas dels fongs no s'ha observat però, influència del medi de cultiu emprat. En el total de 72 soques s'ha observat un percentatge baix de soques que manifesten antagonisme en tots els medis assajats vers 3 o 4 dels patògens (7). Solament 2 d'aquestes 7 soques han mostrat ser també efectives en bioassaigs d'inhibició de les infeccions causades per 2 dels 3 patògens assajats. Algunes de les soques efectives en els bioassaigs no són antagonistes in vitro en cap dels medis assajats enfront el mateix patogen. En el cas de la promoció del creixement, s'han observat més soques promotores del creixement del portaempelts de prunera Marianna 2624 que no en l'híbrid de presseguer-ametller GF677 i les eficàcies assolides són també majors en el cas de Marianna 2624, detectant una elevada especificitat soca/portaempelts La caracterització genotípica s'ha realitzat mitjançant l'anàlisi dels polimorfismes en la longitud dels fragments de restricció de DNA ribosomal (RFLP-rDNA) i l'anàlisi dels polimorfismes en la longitud dels fragments de macrorestricció genòmica de DNA cromosòmic separats per electroforesi en camp polsant (MRFLP-PFGE). Ambdues anàlisis van mostrar una gran heterogeneïtat genètica entre les soques caracteritzades i no s'ha pogut relacionar les agrupacions obtingudes amb les característiques fenotípiques o capacitat d'actuar com a ACB o BPCP. Els patrons de macrorestricció genòmica (MRFLP-PFGE) del bacteri model P. fluorescens EPS288 són estables en el temps i independents de les condicions de cultiu assajades al laboratori o en mostres naturals, mostrant ser una tècnica eficaç en la identificació de reaïllats de mostres naturals inoculades prèviament amb el bacteri. Una selecció de soques que comparteixen el fet de produir floroglucinol s'han caracteritzat mitjançant RFLP i seqüenciació del gen phlD. S'ha establert una relació entre les agrupacions obtingudes en les anàlisis RFLP-rDNA, RFLP-phlD i les seqüències del gen. En l'anàlisi filogenètica de les seqüències del gen phlD s'ha observat un elevat grau de polimorfisme obtenint-se 3 agrupacions principals. Les agrupacions semblen relacionar-se amb els patrons de producció de metabòlits (Phl, HCN i Prn en una primera agrupació; Phl i HCN en la segona i solament Phl en la tercera), però aquestes no s'han pogut relacionar amb l'origen geogràfic de les soques o la seva activitat com a ACBs i/o BPCP. Amb les dades obtingudes de la caracterització fenotípica i genotípica s'ha realitzat una anàlisi multivariant (correspondències, correlacions d'Spearman i de freqüències amb variables categòriques). S'ha demostrat la importància de disposar d'una tècnica que permeti depurar una col·lecció de soques descartant les soques genèticament idèntiques, ja que influeixen en els resultats de les anàlisis. Pels tres patògens assajats com a indicadors i els dos portaempelts emprats, no s'ha observat cap correlació entre la inhibició de la infecció o la promoció del creixement amb les característiques fenotípiques i genotípiques de les soques que fos significatiu i consistent en les tres tècniques emprades.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Diese Arbeit ist ein Beitrag zu den schnell wachsenden Forschungsgebieten der Nano-Biotechnologie und Nanomedizin. Sie behandelt die spezifische Gestaltung magnetischer Nanomaterialien für verschiedene biomedizinische Anwendungsgebiete, wie beispielsweise Kontrastmittel für die magnetische Resonanztomographie (MRT) oder "theragnostische" Agenzien für simultane optische/MR Detektion und Behandlung mittels photodynamischer Therapie (PDT).rnEine Vielzahl magnetischer Nanopartikel (NP) mit unterschiedlichsten magnetischen Eigenschaften wurden im Rahmen dieser Arbeit synthetisiert und erschöpfend charakterisiert. Darüber hinaus wurde eine ganze Reihe von Oberflächenmodifizierungsstrategien entwickelt, um sowohl die kolloidale als auch die chemische Stabilität der Partikel zu verbessern, und dadurch den hohen Anforderungen der in vitro und in vivo Applikation gerecht zu werden. Diese Strategien beinhalteten nicht nur die Verwendung bi-funktionaler und multifunktioneller Polymerliganden, sondern auch die Kondensation geeigneter Silanverbindungen, um eine robuste, chemisch inerte und hydrophile Siliziumdioxid- (SiO2) Schale um die magnetischen NP auszubilden.rnGenauer gesagt, der Bildungsmechanismus und die magnetischen Eigenschaften monodisperser MnO NPs wurden ausgiebig untersucht. Aufgrund ihres einzigartigen magnetischen Verhaltens eignen sich diese NPs besonders als (positive) Kontrastmittel zur Verkürzung der longitudinalen Relaxationszeit T1, was zu einer Aufhellung im entsprechenden MRT-Bild führt. Tatsächlich wurde dieses kontrastverbessernde Potential in mehreren Studien mit unterschiedlichen Oberflächenliganden bestätigt. Au@MnO „Nanoblumen“, auf der anderen Seite, sind Vertreter einer weiteren Klasse von Nanomaterialien, die in den vergangenen Jahren erhebliches Interesse in der wissenschaftlichen Welt geweckt hat und oft „Nano-hetero-Materialien“ genannt wird. Solche Nano-hetero-partikel vereinen die individuellen physikalischen und chemischen Eigenschaften der jeweiligen Komponenten in einem nanopartikulärem System und erhöhen dadurch die Vielseitigkeit der möglichen Anwendungen. Sowohl die magnetischen Merkmale von MnO, als auch die optischen Eigenschaften von Au bieten die Möglichkeit, diese „Nanoblumen“ für die kombinierte MRT und optische Bildgebung zu verwenden. Darüber hinaus erlaubt das Vorliegen zweier chemisch unterschiedlicher Oberflächen die gleichzeitige selektive Anbindung von Katecholliganden (auf MnO) und Thiolliganden (auf Au). Außerdem wurde das therapeutische Potential von magnetischen NPs anhand von MnO NPs demonstriert, die mit dem Photosensibilisator Protoporhyrin IX (PP) funktionalisiert waren. Bei Bestrahlung mit sichtbarem Licht initiiert PP die Produktion von zytotoxisch-reaktivem Sauerstoff. Wir zeigen, dass Nierenkrebszellen, die mit PP-funktionalisierten MnO NPs inkubiert wurden nach Bestrahlung mit Laserlicht verenden, während sie ohne Bestrahlung unverändert bleiben. In einem ähnlichen Experiment untersuchten wir die Eigenschaften von SiO2 beschichteten MnO NPs. Dafür wurde eigens eine neuartige SiO2-Beschichtungsmethode entwickelt, die einer nachfolgende weitere Anbindung verschiedenster Liganden und die Einlagerung von Fluoreszenzfarbstoffen durch herkömmliche Silan- Sol-Gel Chemie erlaubt. Die Partikel zeigten eine ausgezeichnete Stabilität in einer ganzen Reihe wässriger Lösungen, darunter auch physiologische Kochsalzlösung, Pufferlösungen und humanes Blutserum, und waren weniger anfällig gegenüber Mn-Ionenauswaschung als einfache PEGylierte MnO NPs. Des Weiteren konnte bewiesen werden, dass die dünne SiO2 Schicht nur einen geringen Einfluss auf das magnetische Verhalten der NPs hatte, so dass sie weiterhin als T1-Kontrastmittel verwendet werden können. Schließlich konnten zusätzlich FePt@MnO NPs hergestellt werden, welche die individuellen magnetischen Merkmale eines ferromagnetischen (FePt) und eines antiferromagnetischen (MnO) Materials vereinen. Wir zeigen, dass wir die jeweiligen Partikelgrößen, und damit das resultierende magnetische Verhalten, durch Veränderung der experimentellen Parameter variieren können. Die magnetische Wechselwirkung zwischen beiden Materialien kann dabei auf Spinkommunikation an der Grenzfläche zwischen beiden NP-Sorten zurückgeführt werden.rn

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Although the function of metallothionein (MT), a 6- to 7-kDa cysteine-rich metal binding protein, remains unclear, it has been suggested from in vitro studies that MT is an important component of intracellular redox signaling, including being a target for nitric oxide (NO). To directly study the interaction between MT and NO in live cells, we generated a fusion protein consisting of MT sandwiched between two mutant green fluorescent proteins (GFPs). In vitro studies with this chimera (FRET-MT) demonstrate that fluorescent resonance energy transfer (FRET) can be used to follow conformational changes indicative of metal release from MT. Imaging experiments with live endothelial cells show that agents that increase cytoplasmic Ca2+ act via endogenously generated NO to rapidly and persistently release metal from MT. A role for this interaction in intact tissue is supported by the finding that the myogenic reflex of mesenteric arteries is absent in MT knockout mice (MT−/−) unless endogenous NO synthesis is blocked. These results are the first application of intramolecular green fluorescent protein (GFP)-based FRET in a native protein and demonstrate the utility of FRET-MT as an intracellular surrogate indicator of NO production. In addition, an important role of metal thiolate clusters of MT in NO signaling in vascular tissue is revealed.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The telomeric G-rich single-stranded DNA can adopt in vitro an intramolecular quadruplex structure, which has been shown to directly inhibit telomerase activity. The reactivation of this enzyme in immortalized and most cancer cells suggests that telomerase is a relevant target in oncology, and telomerase inhibitors have been proposed as new potential anticancer agents. In this paper, we describe ethidium derivatives that stabilize G-quadruplexes. These molecules were shown to increase the melting temperature of an intramolecular quadruplex structure, as shown by fluorescence and absorbance measurements, and to facilitate the formation of intermolecular quadruplex structures. In addition, these molecules may be used to reveal the formation of multi-stranded DNA structures by standard fluorescence imaging, and therefore become fluorescent probes of quadruplex structures. This recognition was associated with telomerase inhibition in vitro: these derivatives showed a potent anti-telomerase activity, with IC50 values of 18–100 nM in a standard TRAP assay.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We have developed a simple and robust transient expression system utilizing the 25 kDa branched cationic polymer polyethylenimine (PEI) as a vehicle to deliver plasmid DNA into suspension-adapted Chinese hamster ovary cells synchronized in G2/M phase of the cell cycle by anti-mitotic microtubule disrupting agents. The PEI-mediated transfection process was optimized with respect to PEI nitrogen to DNA phosphate molar ratio and the plasmid DNA mass to cell ratio using a reporter construct encoding firefly luciferase. Optimal production of luciferase was observed at a PEI N to DNA P ratio of 10:1 and 5 mug DNA 10(6) cells(-1). To manipulate transgene expression at mitosis, we arrested cells in G2/M phase of the cell cycle using the microtubule depolymerizing agent nocodazole. Using secreted human alkaline phosphatase (SEAP) and enhanced green fluorescent protein (eGFP) as reporters we showed that continued inclusion of nocodazole in cell culture medium significantly increased both transfection efficiency and reporter protein production. In the presence of nocodazole, greater than 90% of cells were eGFP positive 24 h post-transfection and qSEAP was increased almost fivefold, doubling total SEAP production. Under optimal conditions for PEI-mediated transfection, transient production of a recombinant chimeric IgG(4) encoded on a single vector was enhanced twofold by nocodazole, a final yield of approximately 5 mug mL(-1) achieved at an initial viable cell density of 1 x 10(6) cells mL(-1). The glycosylation of the recombinant antibody at Asn(297) was not significantly affected by nocodazole during transient production by this method. (C) 2004 Wiley Periodicals, Inc.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The efficient transport of micron-sized beads into cells, via a non-endocytosis mediated mechanism, has only recently been described. As such there is considerable scope for optimization and exploitation of this procedure to enable imaging and sensing applications to be realized. Herein, we report the design, synthesis and characterization of fluorescent microsphere-based cellular delivery agents that can also carry biological cargoes. These core-shell polymer microspheres possess two distinct chemical environments; the core is hydrophobic and can be labeled with fluorescent dye, to permit visual tracking of the microsphere during and after cellular delivery, whilst the outer shell renders the external surfaces of the microspheres hydrophilic, thus facilitating both bioconjugation and cellular compatibility. Cross-linked core particles were prepared in a dispersion polymerization reaction employing styrene, divinylbenzene and a thiol-functionalized co-monomer. These core particles were then shelled in a seeded emulsion polymerization reaction, employing styrene, divinylbenzene and methacrylic acid, to generate orthogonally functionalized core-shell microspheres which were internally labeled via the core thiol moieties through reaction with a thiol reactive dye (DY630-maleimide). Following internal labeling, bioconjugation of green fluorescent protein (GFP) to their carboxyl-functionalized surfaces was successfully accomplished using standard coupling protocols. The resultant dual-labeled microspheres were visualized by both of the fully resolvable fluorescence emissions of their cores (DY630) and shells (GFP). In vitro cellular uptake of these microspheres by HeLa cells was demonstrated conventionally by fluorescence-based flow cytometry, whilst MTT assays demonstrated that 92% of HeLa cells remained viable after uptake. Due to their size and surface functionalities, these far-red-labeled microspheres are ideal candidates for in vitro, cellular delivery of proteins, as described in the accompanying paper.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Solid tumours display a complex drug resistance phenotype that involves inherent and acquired mechanisms. Multicellular resistance is an inherent feature of solid tumours and is known to present significant barriers to drug permeation in tumours. Given this barrier, do acquired resistance mechanisms such as P-glycoprotein (P-gp) contribute significantly to resistance? To address this question, the multicellular tumour spheroid (MCTS) model was used to examine the influence of P-gp on drug distribution in solid tissue. Tumour spheroids (TS) were generated from either drug-sensitive MCF7WT cells or a drug-resistant, P-gp-expressing derivative MCF7Adr. Confocal microscopy was used to measure time courses and distribution patterns of three fluorescent compounds; calcein-AM, rhodamine123 and BODIPY-taxol. These compounds were chosen because they are all substrates for P-gp-mediated transport, exhibit high fluorescence and are chemically dissimilar. For example, BODIPY-taxol and rhodamine 123 showed high accumulation and distributed extensively throughout the TSWT, whereas calcein-AM accumulation was restricted to the outermost layers. The presence of P-gp in TSAdr resulted in negligible accumulation, regardless of the compound. Moreover, the inhibition of P-gp by nicardipine restored intracellular accumulation and distribution patterns to levels observed in TSWT. The results demonstrate the effectiveness of P-gp in modulating drug distribution in solid tumour models. However, the penetration of agents throughout the tissue is strongly determined by the physico-chemical properties of the individual compounds.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Aim: To evaluate the effect of different in-office bleaching agents on the permeability, roughness and surface microhardness of human enamel. Methods: For evaluation of roughness and microhardness, 40 hemi-faces of 20 premolars were subjected to initial roughness (Ra parameter) and microhardness (VHN) measurements. Thirty-two premolar’s crowns were used for permeability test. Then, all specimens were randomly divided into four groups: C - without bleaching (control), HP35 - bleaching with 35% hydrogen peroxide (HP), HPF38 - 38% HP+fluoride, HPC35 - 35% HP+calcium. Final roughness (FR) and microhardness (FM) measurements were evaluated. For permeability, the 32 crowns were immersed in 1% sodium hypochlorite (20 min) and silver nitrate solutions (2 h) and subjected to developing solution under fluorescent light (16 h). Three sections from the crowns were analyzed in light microscope (100x) to evaluate the scores of permeability: Score 0 - no tracer agent penetration; Score 1 - less than half the thickness of enamel penetration; Score 2 - tracer agent reaching half the enamel thickness; Score 3 - entire enamel depth penetration, without reaching dentin and Score 4 - tracer agent reaching dentin. For roughness and microhardness evaluation were used one-way ANOVA and Dunnet post-test for independent samples, and t test for paired samples. For permeability, the data were analyzed by Kruskal Wallis and Dunn tests. Results: A significantly higher permeability and surface roughness were observed in groups HP35, HPF38 and HPC35 compared to the C group, as well as decreased microhardness (p<0.05). Conclusions: All bleaching agents increased permeability and surface roughness, and decreased microhardness of human enamel; thus, the addition of fluoride or calcium was not beneficial.