Application of real-time fluorescent PCR for quantitative assessment of Neospora caninum infections in organotypic slice cultures of rat central nervous system tissue

The previously described Nc5-specific PCR test for the diagnosis of Neospora caninum infections was used to develop a quantitative PCR assay which allows the determination of infection intensities within different experimental and diagnostic sample groups. The quantitative PCR was performed by using a dual fluorescent hybridization probe system and the LightCycler Instrument for online detection of amplified DNA. This assay was successfully applied for demonstrating the parasite proliferation kinetics in organotypic slice cultures of rat brain which were infected in vitro with N. caninum tachyzoites. This PCR-based method of parasite quantitation with organotypic brain tissue samples can be regarded as a novel ex vivo approach for exploring different aspects of cerebral N. caninum infection.

Prenatal diagnosis of tetrasomy 18p using multiplex fluorescent PCR and comparison with a variety of techniques

We report genetic characterization of isochromosome 18p using a combination of cytogenetic and molecular genetic methods, including multiplex fluorescent PCR. The patient was referred for chorionic villus sampling (CVS) due to advanced maternal age and maternal anxiety. The placental karyotype was 47,XX,+mar, with the marker having the appearance of a small supernumerary isochromosome. Because differentiating between isochromosomes and other structural rearrangements is normally very difficult, a variety of genetic tests including fluorescence in situ hybridization (FISH), PCR, and multiplex fluorescent PCR were undertaken to determine chromosomal origin and copy number and, thus, allow accurate diagnosis of the corresponding syndrome. FISH determined that the marker chromosome contained chromosome 18 material. PCR of a variety of short tandem repeats (STRs) confirmed that there was at least one extra copy of the maternal 18p material. However, neither FISH nor PCR could accurately determine copy number. Multiplex fluorescent PCR (MF-PCR) of STRs simultaneously determined that: (1) the marker included 18p material; (2) the marker was maternal in origin; (3) allele copy number indicated tetrasomy; and (4) contamination of the sample could be ruled out. Results were also rapid with accurate diagnosis of the syndrome tetrasomy 18p possible within 5 hours.

Using MF-PCR to diagnose multiple defects from single cells: implications for PGD

Single cell genetic analysis is generally performed using PCR and FISH. Until recently, FISH has been the method of choice. FISH however is expensive, has significant misdiagnosis rates, can result in interpretation difficulties and is labour intensive making it unsuitable for high throughput processing. Recently fluorescent PCR reliability has increased to levels at or surpassing FISH whilst maintaining low cost. However, PCR accuracy has been a concern due to allelic dropout. Multiplex PCR can now increase accuracy by using multiple markers for each chromosome to firstly provide diagnosis if markers fail and,or secondly confirm diagnosis. We compare a variety of diagnostic methods and demonstrate for the first time a multiplex PCR system providing simultaneous diagnosis and confirmation of the major aneuploidy chromosomes (21, 18, 13) and sex as well as DNA fingerprint in single cells. We also discuss the implications of using PCR for aneuploidy screening in preimplantation genetic diagnosis. (C) 2001 Elsevier Science Ireland Ltd. All rights reserved.

PCR Multiplex fluorescente para detecção de bactérias em sêmen bovino

Este estudo teve como objetivo avaliar o limiar de detecção da técnica de PCR multiplex fluorescente aliada a eletroforese capilar na detecção de agentes infecciosos em amostras de sêmen experimentalmente contaminadas com concentrações decrescentes das bactérias Brucella abortus, Leptospira interrogans sorovar pomona, Campylobacter fetus e Haemophilus somnus. Amostras de sêmen bovino foram experimentalmente contaminadas com concentrações decrescentes de bactérias obtidas através de diluições seriadas na base 10 de modo a obter-se amostras contendo desde 1 vez até 10-7 bactérias/mL a partir da concentração inicial de Leptospira pomona, Brucella abortus, Campylobacter fetus e Haemophilus somnus. As diluições foram efetuadas individualmente para cada bactéria, bem como nas diferentes concentrações necessárias para a padronização do teste de multiplex PCR. As extrações de DNA de todas as soluções contendo espermatozóides e bactérias analisadas no presente estudo foram realizadas segundo protocolo descrito por Heinemann et al. (2000). Os produtos de PCR multiplex foram avaliados por eletroforese em gel de poliacrilamida 8% e separação eletroforética por sistema capilar em equipamento automático de análise de fragmentos de DNA MegaBace. Observou-se a amplificação de fragmentos de 193pb, 330pb, 400pb e 415pb a partir do DNA de B. abortus, L. pomona, H. somnus, C. fetus, respectivamente. Na análise por eletroforese capilar de produtos da PCR multiplex do DNA para detecção simultânea dos quatro patógenos observou-se a sinal de positividade até a diluição de 10-3 bactérias/mL vezes da concentração inicial da solução estoque de cada bactéria. A técnica de PCR multiplex aliada à eletroforese capilar foi usada pela primeira vez para o diagnóstico direto de quatro bactérias patogênicas no sêmen, demonstrando ser um método rápido na detecção de bactérias causadoras de doenças reprodutivas.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

EmsB, a tandem repeated multi-loci microsatellite, new tool to investigate the genetic diversity of Echinococcus multilocularis

In order to explore the genetic diversity within Echinococcus multilocularis (E. multilocularis), the cestode responsible for the alveolar echinococcosis (AE) in humans, a microsatellite, composed of (CA) and (GA) repeats and designated EmsB, was isolated and characterized in view of its nature and potential field application. PCR-amplification with specific primers exhibited a high degree of size polymorphism between E. multilocularis and Echinococcus granulosus sheep (G1) and camel (G6) strains. Fluorescent-PCR was subsequently performed on a panel of E. multilocularis isolates to assess intra-species polymorphism level. EmsB provided a multi-peak profile, characterized by tandemly repeated microsatellite sequences in the E. multilocularis genome. This "repetition of repeats" feature provided to EmsB a high discriminatory power in that eight clusters, supported by bootstrap p-values larger than 95%, could be defined among the tested E. multilocularis samples. We were able to differentiate not only the Alaskan from the European samples, but also to detect different European isolate clusters. In total, 25 genotypes were defined within 37 E. multilocularis samples. Despite its complexity, this tandem repeated multi-loci microsatellite possesses the three important features for a molecular marker, i.e. sensitivity, repetitiveness and discriminatory power. It will permit assessing the genetic polymorphism of E. multilocularis and to investigate its spatial distribution in detail.

Ligation dependent allele specific quantification (LASQ) of CFTR cDNA on the LightCycler using MLPA hybridization probes

BACKGROUND: As for Cystic Fibrosis (CF) and many other hereditary diseases there is still a lack in understanding the relationship between genetic (e.g. allelic) and phenotypic diversity. Therefore methods which allow fine quantification of allelic proportions of mRNA transcripts are of high importance. METHODS: We used either genomic DNA (gDNA) or total RNA extracted from nasal cells as starting nucleic acid template for our assay. The subjects included in this study were 9 CF patients compound heterozygous for the F508del mutation and each one F508del homozygous and one wild type homozygous respectively. We established a novel ligation based quantification method which allows fine quantification of the allelic proportions of ss and ds CFTR cDNA. To verify reliability and accuracy of this novel assay we compared it with semiquantitative fluorescent PCR (SQF-PCR). RESULTS: We established a novel assay for allele specific quantification of gene expression which combines the benefits of the specificity of the ligation reaction and the accuracy of quantitative real-time PCR. The comparison with SQF-PCR clearly demonstrates that LASQ allows fine quantification of allelic proportions. CONCLUSION: This assay represents an alternative to other fine quantitative methods such as ARMS PCR and Pyrosequencing.

Multi-locus microsatellite analysis supports the hypothesis of an autochthonous focus of Echinococcus multilocularis in northern Italy

Echinococcus multilocularis is characterised by a wide geographical distribution, encompassing three continents (North America, Asia and Europe) yet very low genetic variability is documented. Recently, this parasite has been detected in red foxes (Vulpes vulpes) circulating in an Alpine region of Italy, close to Austria. This finding raised the question as to whether an autochthonous cycle exists in Italy or whether the infected foxes originated from the neighbouring regions of Austria. Studies have shown that multi-locus microsatellite analysis can identify genomic regions carrying mutations that result in a local adaptation. We used a tandem repeated multi-locus microsatellite (EmsB) to evaluate the genetic differences amongst adult worms of E. multilocularis collected in Italy, worms from neighbouring Austria and from other European and extra-European countries. Fluorescent PCR was performed on a panel of E. multilocularis samples to assess intra-specific polymorphism. The analysis revealed four closed genotypes for Italian samples of E. multilocularis which were unique compared with the other 25 genotypes from Europe and the five genotypes from Alaska. An analysis in the Alpine watershed, comparing Italian adult worms with those from neighbouring areas in Austria, showed a unique cluster for Italian samples. This result supports the hypothesis of the presence of an autochthonous cycle of E. multilocularis in Italy. EmsB can be useful for 'tracking' the source of infection of this zoonotic parasite and developing appropriate measures for preventing or reducing the risk of human alveolar echinococcosis.

Fluorescent quantitative PCR of Mycobacterium tuberculosis for differentiating intestinal tuberculosis from Crohn's disease

Intestinal tuberculosis (ITB) and Crohn's disease (CD) are granulomatous disorders with similar clinical manifestations and pathological features that are often difficult to differentiate. This study evaluated the value of fluorescent quantitative polymerase chain reaction (FQ-PCR) for Mycobacterium tuberculosis (MTB) in fecal samples and biopsy specimens to differentiate ITB from CD. From June 2010 to March 2013, 86 consecutive patients (38 females and 48 males, median age 31.3 years) with provisional diagnoses of ITB and CD were recruited for the study. The patients' clinical, endoscopic, and histological features were monitored until the final definite diagnoses were made. DNA was extracted from 250 mg fecal samples and biopsy tissues from each patient. The extracted DNA was amplified using FQ-PCR for the specific MTB sequence. A total of 29 ITB cases and 36 CD cases were included in the analysis. Perianal disease and longitudinal ulcers were significantly more common in the CD patients (P<0.05), whereas night sweats, ascites, and circumferential ulcers were significantly more common in the ITB patients (P<0.05). Fecal FQ-PCR for MTB was positive in 24 (82.8%) ITB patients and 3 (8.3%) CD patients. Tissue PCR was positive for MTB in 16 (55.2%) ITB patients and 2 (5.6%) CD patients. Compared with tissue FQ-PCR, fecal FQ-PCR was more sensitive (X2=5.16, P=0.02). We conclude that FQ-PCR for MTB on fecal and tissue samples is a valuable assay for differentiating ITB from CD, and fecal FQ-PCR has greater sensitivity for ITB than tissue FQ-PCR.

Application of conventional and real-time fluorescent ITS1 rDNA PCR for detection of Besnoitia besnoiti infections in bovine skin biopsies

Besnoitia besnoiti, an apicomplexan protozoan parasite, is the causative agent of bovine besnoitiosis. This infection may dramatically affect body condition, and, in males, lead to irreversible infertility. While identification of clinical cases and their histopathological confirmation is relatively simple to carry out, finding subclinical forms of infection is more difficult, thus a more sensitive test for the identification of the etiological agent may be an appropriate diagnostic tool. We have developed the ITS1 rDNA-sequence-based conventional and real-time PCR which are highly sensitive and specific for the detection of B. besnoiti infection in cattle. A recombinant internal positive control was introduced to assess possible sample-related inhibitory effects during the amplification reaction and, in order to prevent false-positive results, a pre-PCR treatment of potentially contaminating dU-containing PCR product with uracil-DNA-glycosylase (UDG) was followed.

A Practical Teaching Course in Directed Protein Evolution Using the Green Fluorescent Protein as a Model

Protein engineering is a powerful tool, which correlates protein structure with specific functions, both in applied biotechnology and in basic research. Here, we present a practical teaching course for engineering the green fluorescent protein (GFP) from Aequorea victoria by a random mutagenesis strategy using error-prone polymerase chain reaction. Screening of bacterial colonies transformed with random mutant libraries identified GFP variants with increased fluorescence yields. Mapping the three-dimensional structure of these mutants demonstrated how alterations in structural features such as the environment around the fluorophore and properties of the protein surface can influence functional properties such as the intensity of fluorescence and protein solubility.

Quantitative PCR-ELAHA for the determination of retroviral vector transduction efficiency

Current methods to detect transduction efficiency during the routine use of integrating retroviral vectors in gene therapy applications may require the use of radioactivity and usually rely upon subjective determination of the results. We have developed two competitive quantitative assays that use an enzyme-linked, amplicon hybridization assay (ELAHA) to detect the products of PCR-amplified regions of transgene from cells transduced with Moloney murine leukemia virus vectors. The quantitative assays (PCR-ELAHA) proved to be simple, rapid, and sensitive, avoiding the need for Southern hybridization, complex histochemical stains, or often subjective and time-consuming tissue culture and immunofluorescence assays. The PCR-ELAHA systems can rapidly detect proviral DNA from any retroviral vector carrying the common selective and marker genes neomycin phosphotransferase and green fluorescent protein, and the methods described are equally applicable to other sequences of interest, providing a cheaper alternative to the evolving real-time PCR methods. The results revealed the number of copies of retrovector provirus present per stably transduced cell using vectors containing either one or both qPCR targets.

Detection of human respiratory syncytial virus in respiratory samples by LightCycler reverse transcriptase PCR

Laboratory diagnosis of human respiratory syncytial virus (hRSV) infections has traditionally been performed by virus isolation in cell culture and the direct fluorescent-antibody assay (DFA). Reverse transcriptase PCR (RT-PCR) is now recognized as a sensitive and specific alternative for detection of hRSV in respiratory samples. Using the LightCycler instrument, we developed a rapid RT-PCR assay for the detection of hRSV (the LC-RT-PCR) with a pair of hybridization probes that target the hRSV L gene. In the present study, 190 nasopharyngeal aspirate samples from patients with clinically recognized respiratory tract infections were examined for hRSV. The results were then compared to the results obtained with a testing algorithm that combined DFA and a culture-augmented DFA (CA-DFA) assay developed in our laboratory. hRSV was detected in 77 (41%) specimens by LC-RT-PCR and in 75 (39%) specimens by the combination of DFA and CA-DFA. All specimens that were positive by the DFA and CA-DFA testing algorithm were positive by the LC-RT-PCR. The presence of hRSV RNA in the two additional LC-RT-PCR-positive specimens was confirmed by a conventional RT-PCR method that targets the hRSV N gene. The sensitivity of LC-RT-PCR was 50 PFU/ml; and this, together with its high specificity and rapid turnaround time, makes the LC-RT-PCR suitable for the detection of hRSV in clinical specimens.

Multicenter, Prospective Clinical Evaluation of Respiratory Samples from Subjects at Risk for Pneumocystis jirovecii Infection by Use of a Commercial Real-Time PCR Assay.

Pneumocystis jirovecii pneumonia (PCP) is a common opportunistic infection. Microscopic diagnosis, including diagnosis using the Merifluor-Pneumocystis direct fluorescent antigen (MP-DFA) test, has limitations. Real-time PCR may assist in diagnosis, but no commercially validated real-time PCR assay has been available to date. MycAssay Pneumocystis is a commercial assay that targets the P. jirovecii mitochondrial large subunit (analytical detection limit, ≤3.5 copies/μl of sample). A multicenter trial recruited 110 subjects: 54 with transplants (40 with lung transplants), 32 with nonmalignant conditions, 13 with leukemia, and 11 with solid tumors; 9 were HIV positive. A total of 110 respiratory samples (92% of which were bronchoalveolar lavage [BAL] specimens) were analyzed by PCR. Performance was characterized relative to investigator-determined clinical diagnosis of PCP (including local diagnostic tests), and PCR results were compared with MP-DFA test results for 83 subjects. Thirteen of 14 subjects with PCP and 9/96 without PCP (including 5 undergoing BAL surveillance after lung transplantation) had positive PCR results; sensitivity, specificity, and positive and negative predictive values (PPV and NPV, respectively) were 93%, 91%, 59%, and 99%, respectively. Fourteen of 83 subjects for whom PCR and MP-DFA test results were available had PCP; PCR sensitivity, specificity, PPV, and NPV were 93%, 90%, 65%, and 98%, respectively, and MP-DFA test sensitivity, specificity, PPV, and NPV were 93%, 100%, 100%, and 98%. Of the 9 PCR-positive subjects without PCP, 1 later developed PCP. The PCR diagnostic assay compares well with clinical diagnosis using nonmolecular methods. Additional positive results compared with the MP-DFA test may reflect low-level infection or colonization.