945 resultados para extraction method
Resumo:
Even though linkages have attracted a lot of research interest, few researchers focus on the intersectoral linkages between two specific sectors. This research therefore proposes an indirect intersectoral linkage measure model to explore linkages between the real estate and construction sectors using the Hypothetical Extraction Method (HEM). Using the OECD input-output tables, the direct, total intersectoral linkages and the proposed indirect intersectoral linkages are explored and tested respectively for seven OECD countries over twenty years. The findings describe that the intersectoral linkages from construction to real estate are larger than those from real estate to construction. The statistical testing results imply that the proposed indirect intersectoral linkage measure method seems to be appropriate to analyse the intersectoral linkage between the construction and real estate sectors.
Resumo:
Endocrine disrupting chemicals (EDCs) can alter endocrine function in exposed animals. Such critical effects, combined with the ubiquity of EDCs in sewage effluent and potentially in tapwater, have led to concerns that they could be major physiological disruptors for wildlife and more controversially for humans. Although sewage effluent is known to be a rich source of EDCs, there is as yet no evidence for EDC uptake by invertebrates that live within the sewage treatment system. Here, we describe the use of an extraction method and GC–MS for the first time to determine levels of EDCs (e.g., dibutylphthalate, dioctylphthalate, bisphenol-A and 17β-estradiol) in tissue samples from earthworms (Eisenia fetida) living in sewage percolating filter beds and garden soil. To the best of our knowledge, this is the first such use of these techniques to determine EDCs in tissue samples in any organism. We found significantly higher concentrations of these chemicals in the animals from sewage percolating filter beds. Our data suggest that earthworms can be used as bioindicators for EDCs in these substrates and that the animals accumulate these compounds to levels well above those reported for waste water. The potential transfer into the terrestrial food chain and effects on wildlife are discussed.
Resumo:
Personal identification of individuals is becoming increasingly adopted in society today. Due to the large number of electronic systems that require human identification, faster and more secure identification systems are pursued. Biometrics is based upon the physical characteristics of individuals; of these the fingerprint is the most common as used within law enforcement. Fingerprint-based systems have been introduced into the society but have not been well received due to relatively high rejection rates and false acceptance rates. This limited acceptance of fingerprint identification systems requires new techniques to be investigated to improve this identification method and the acceptance of the technology within society. Electronic fingerprint identification provides a method of identifying an individual within seconds quickly and easily. The fingerprint must be captured instantly to allow the system to identify the individual without any technical user interaction to simplify system operation. The performance of the entire system relies heavily on the quality of the original fingerprint image that is captured digitally. A single fingerprint scan for verification makes it easier for users accessing the system as it replaces the need to remember passwords or authorisation codes. The identification system comprises of several components to perform this function, which includes a fingerprint sensor, processor, feature extraction and verification algorithms. A compact texture feature extraction method will be implemented within an embedded microprocessor-based system for security, performance and cost effective production over currently available commercial fingerprint identification systems. To perform these functions various software packages are available for developing programs for windows-based operating systems but must not constrain to a graphical user interface alone. MATLAB was the software package chosen for this thesis due to its strong mathematical library, data analysis and image analysis libraries and capability. MATLAB enables the complete fingerprint identification system to be developed and implemented within a PC environment and also to be exported at a later date directly to an embedded processing environment. The nucleus of the fingerprint identification system is the feature extraction approach presented in this thesis that uses global texture information unlike traditional local information in minutiae-based identification methods. Commercial solid-state sensors such as the type selected for use in this thesis have a limited contact area with the fingertip and therefore only sample a limited portion of the fingerprint. This limits the number of minutiae that can be extracted from the fingerprint and as such limits the number of common singular points between two impressions of the same fingerprint. The application of texture feature extraction will be tested using variety of fingerprint images to determine the most appropriate format for use within the embedded system. This thesis has focused on designing a fingerprint-based identification system that is highly expandable using the MATLAB environment. The main components that are defined within this thesis are the hardware design, image capture, image processing and feature extraction methods. Selection of the final system components for this electronic fingerprint identification system was determined by using specific criteria to yield the highest performance from an embedded processing environment. These platforms are very cost effective and will allow fingerprint-based identification technology to be implemented in more commercial products that can benefit from the security and simplicity of a fingerprint identification system.
Resumo:
The increasing consumption of sucrose has resulted in several nutritional and medicinal problems, including obesity. There is an alarming rise in the prevalence of obesity, type 2 diabetes mellitus, and metabolic syndrome in children and adults around the world, partly related to increasing availability of energy-dense, high-calorie foods, and perhaps to increased consumption of sugar and particularly fructose sweetened beverages. Therefore, low calorie sweeteners are urgently required to substitute table sugar.
Stevioside, a diterpene glycoside, is well known for its intense sweetness and is used as a non-caloric sweetener. Its potential widespread use requires an easy and effective extraction method. Enzymatic extraction of stevioside from Stevia rebaudiana leaves with cellulase, pectinase and hemicellulase using various parameters such as concentration of enzyme, incubation time and temperature was optimized. The extraction conditions were further optimized using response surface methodology (RSM). Under the optimized conditions, the experimental values were in close agreement with predicted model and resulted in a three times yield enhancement of stevioside.
Various studies have revealed that in addition to sweetening nature of stevisoide, it exerts beneficial effects including antihypertensive, anti-hyperglycemic, anti-human rotavirus, antioxidant, anti-inflammatory and antitumor actions. Its anti-amnesic potential remains to be explored, therefore the present study has been undertaken to investigate the beneficial effect of stevioside in memory deficit of rats employing scopolamine induced amnesia as an animal model.
Significance: Stevia is gaining significance in different parts of the world and is expected to develop into a major source of high potency sweetener for the growing natural food market. There is a strong possibility that Stevia sweeteners could replace aspartame in some diet variants. In addition, Stevia is expected to be used as a part substitute for sugar and also used in combination with other artificial sweeteners in the emerging phase of life cycle.
Resumo:
Offline handwritten recognition is more challenging as indicated by the recognition technologies. This study demonstrates significantly higher rates recognition when compared with other comparable studies. In this paper, we present a circular grid zoning method applied on Polar transformation recognition system. It compares the circular grid zoning (CGZ) and standard zoning (SZ) feature extraction method on Polar and Cartesian coordinate system. We report recognition rates of 92.3%, which are considerably higher than previous studies of zoning based Polar transformation system (86.6%) and zoning based Cartesian recognition system (80.6%). Based on the finding, we propose that our circular grid zoning based Polar transformation system may provide improved classification rates for complex offline handwritten recognition.
Resumo:
This paper introduces a hybrid feature extraction method applied to mass spectrometry (MS) data for cancer classification. Haar wavelets are employed to transform MS data into orthogonal wavelet coefficients. The most prominent discriminant wavelets are then selected by genetic algorithm (GA) to form feature sets. The combination of wavelets and GA yields highly distinct feature sets that serve as inputs to classification algorithms. Experimental results show the robustness and significant dominance of the wavelet-GA against competitive methods. The proposed method therefore can be applied to cancer classification models that are useful as real clinical decision support systems for medical practitioners.
Resumo:
Agricultural and agro-industrial residues are often considered both an environmental and an economical problem. Therefore, a paradigm shift is needed, assuming residues as biorefinery feedstocks. In this work cherimoya (Annona cherimola Mill.) seeds, which are lipid-rich (ca. 30%) and have a significant lignocellulosic fraction, were used as an example of a residue without any current valorization. Firstly, the lipid fraction was obtained by solvent extraction. Extraction yield varied from 13% to 28%, according to the extraction method and time, and solvent purity. This oil was converted into biodiesel (by base-catalyzed transesterification), yielding 76 g FAME/100 g oil. The obtained biodiesel is likely to be incorporated in the commercial chain, according to the EN14214 standard. The remaining lignocellulosic fraction was subjected to two alternative fractionation processes for the selective recovery of hemicellulose, aiming different products. Empirical mathematical models were developed for both processes, aiming future scale-up. Autohydrolysis rendered essentially oligosaccharides (10 gL-1) with properties indicating potential food/feed/pharmacological applications. The remaining solid was enzymatically saccharified, reaching a saccharification yield of 83%. The hydrolyzate obtained by dilute acid hydrolysis contained mostly monosaccharides, mainly xylose (26 gL-1), glucose (10 gL-1) and arabinose (3 gL-1), and had low content of microbial growth inhibitors. This hydrolyzate has proven to be appropriate to be used as culture media for exopolisaccharide production, using bacteria or microbial consortia. The maximum conversion of monosaccharides into xanthan gum was 0.87 g/g and kefiran maximum productivity was 0.07 g.(Lh)-1. This work shows the technical feasibility of using cherimoya seeds, and materials as such, as potential feedstocks, opening new perspectives for upgrading them in the biorefinery framework.
Resumo:
This paper aims to verify the Burnout´s possibilities of incidence, finding the creating dimensions and comparing with the socio-demographics characteristics of the researched professionals. This quantitative-descriptive search has a population of 197 workers of 23 nourishing companies in Rio Grande do Norte. This population is predominantly male, younger than 28 years old, single, relatively instructed (57,07% with complete high school) and having just started their current job since 79% of the interviewees are in the company less than six years. The AUDITORIA DO SISTEMA HUMANO (ASH) model, utilized for investigation and developed for the Spaniards Quijano and Navarro in 1999, has several dimensions about human resources management and the organizational effectiveness, but only makes part of the research in 19 questions Burnout referring. It was used factorial analyses with extraction method, varimax rotation and Kaiser normalization with the intuition to define the creating dimensions of the syndrome, they were evaluated with Cronbach Alpha coefficient after extraction. The dimensions found through the factorial analyses were: emotional exhaustion, physical exhaustion and vitality. The accumulated explanation value reached 65,30% of total variation. The data socio-demographics don t justify the syndrome appearance, because the T test and ANOVA showed irrelevant values. It has been also observed that the founded dimensions were different of the Maslach sociopsychological perspective (emotional exhaustion, depersonalization and low professional realization) allowing comparison with others researches and the possibility to develop new ones with workers from different assistance areas. These new researches are important, since the syndrome refers to chronic labor stress consequences and any professional is favorable to Burnout, harmful to the company as to the collaborators
Resumo:
With the need of the companies in becoming more competitive within the market, it arises an incessant search for selective human potential, with a high level of capacity and low rotativity, which motivation results in production raise, quality optimization and waste reduction. This scenario requires a strategy development which advantages the Human Resources Quality Management. This way, the model of the Human System Audit (HSA), developed by the Spanish researchers Ouijano and Navarro, presents itself as an important tool to diagnosis and evaluation, contemplating the environment where the organization is inserted, its strategies, its organizational design, its processes and its organizational effectiveness. In this sense, the present study has identified the existent relation between the professional satisfaction and the Organizational Culture, based in the model HSA. The research has been a quantitative-descriptive one and has had as population the technical-administrative workers from the Federal Center of Technical Education of Rio Grande do Norte (CEFET RN). The data collection has occurred during May, 2008, by means of the application of a questionnaire in the HSA model. The sample was composed by 167 subjects, distributed among the Five units of the institution. It was used the factorial analysis, with the extraction method of main components and orthogonal rotation varimax, in order to extract the dimensions of the satisfaction and of the organizational culture and the calculation of Cronbach s Alpha coefficient, to evaluate the reliability of these dimensions. The factorial analysis of the satisfaction indicators has identified four factors,, all of them showing significance: gratefulness and relationship , self-realization , stability and security and physical conditions and social benefits . The result of the factorial analysis with the indicators of the organizational culture has extracted four factors and among them, three of them have obtained significance: Personal Satisfaction Style , Competitive-Denial-Power Style and the Conventional-Dependent Style . After identifying the dimensions of the satisfaction and culture found at CEFET-RN, it has been notice the existence or not of relation among them, through the application of Pearson s coefficient. It has been verified that all of the dimensions of the Professional satisfaction are correlated with some dimension of the organizational culture, having in outstand position, with higher intensity, the relation between the culture style of Personal Satisfaction and the satisfaction factor referring to the self-realization
Resumo:
Currently the organizations are passing for continuous cycles of changes due to necessity of survival in the work market. The administration of the future points a way to the organizations of today and tomorrow, the search of the competitiveness from loyalty and motivation of its staff. Of this form, the model of the Auditoria do Sistema Humano (ASH), developed for Spanish researchers and that now it is being applied in Brazil, contemplates a series of dimensions about Human Resources management quality in the companies and the organizational effectiveness, such as the environment where the company is inserted, the strategies, the organizational drawing, the psychological and psychosocial processes, e the reached results. In this direction, the present research analyzed the factors of job satisfaction and organizational commitment, making, also, a relation of causality between the same ones. The quantitative-descriptive research had as population the employees of twenty three nourishing industries of the State of Rio Grande do Norte (Brazil), registered in the Federacy of the Industries of the state. The collection of the data occurred for the months of October of 2005 and March of 2006, by means of the application of questionnaire of model ASH. The sample was composed for 197 employees, however it was observed presence of five outliers, that they had been excluded from the analysis of the data. To extract the dimensions of the satisfaction and the commitment and identification the factorial analysis was used, with extraction method of principal components, rotation Varimax and normalization Kaiser. The gotten dimensions had been evaluated with the calculation of the coefficient Alpha of Cronbach. The factorial analysis of the pointers of the organizational commitment and identification had extracted ten factors. Of these, four had gotten significance of the analyses inside: affective commitment, values commitment, continuance commitment and necessity commitment. The result of the analysis of the pointers of job satisfaction indicated four factors: extrinsic, motivations, relation with the friends and auto-accomplishment. To deal with the data the relation between job satisfaction and organizational commitment it was used technique of multiple regression. The correlation between commitment and satisfaction was satisfactory, detaching the affective commitment with bigger index of correlation, followed of the affective one
Resumo:
Dengue, amongst the virus illnesses one can get by vectorial transmission, is the one that causes more impact in the morbidity and mortality of world s population. The resistance to the insecticides has caused difficulties to control of vector insect (Aedes aegypti) and has stimulated a search for vegetables with larvicidal activity. The biodiversity of Caatinga is barely known and it is potential of use even less. Some plants of this biome are commercialized in free fairs northeast of Brazil, because of its phytotherapics properties. The vegetables in this study had been selected by means of a questionnaire applied between grass salesmen and natives of the Serido region from Rio Grande do Norte state; culicids eggs had been acquired with traps and placed in container with water for the larva birth. Thirty larvae had been used in each group (a group control and five experimental groups), with four repetitions four times. The vegetables had been submitted to the processes of decoction, infusion and maceration in the standard concentration of 100g of the vegetable of study in 1l of H2O and analyzed after ½, 1, 2, 4, 8, 12, 24 and 48 hours for verification of the average lethal dose (LD50) from the groups with thirty larva. The LD50 was analyzed in different concentrations (50g/l, 100g/l, 150g/l, 200g/l e 300g/l) of Aspidosperma pyrifolium Mart. 48 extracts of rind, leaf and stem of the seven vegetal species: Aspidosperma pyrifolium Mart., Mimosa verrucosa Benth, Mimosa hostilis (Mart.) Benth., Myracrodruon urundeuva Allemão, Ximenia americana L, Bumelia sartorum Mart Zizyphus joazeiro Mart, had been analyzed. The extracts proceeding from the three methods were submitted to the freezedrying, to evaluate and to quantify substances extracted in each process. The results had shown that Aspidosperma pyrifolium Mart. and Myracrodruon urundeuva Allemão are the species that are more distinguished as larvicidal after 24 hours of experiment, in all used processes of extraction in the assays. The Zizyphus joazeiro Mart species has not shown larvicidal activity in none of the assays. In relation to the extraction method, the decoction was the most efficient method in the mortality tax of the A. aegypti larvae
Resumo:
Kalanchoe brasiliensis Cambess (Crassulaceae), commonly known as saião , coirama branca , folha grossa , is originally from Brazil and commonly found in São Paulo to Bahia, mainly in the coastal zone. Regarding of biological activities, most preclinical studies were found in the literature, mainly about the anti-inflammatory activity of extracts obtained from leaves and / or aerial parts of K. brasiliensis. As regards the chemical constitution, it has been reported mainly the presence of flavonoids in the leaves of the species, but until this moment did not knows which are the active compounds. Although it is a species widely used in traditional medicine in Brazil, there is no monograph about the quality parameters of the plant drug. In this context, this study aims to characterize and quantify the chemical markers of hydroethanolic extract (HE) from the leaves of K. brasiliensis, which can be used in quality control of plant drug and derivatives obtained from this species. The methodology was divided into two parts: i. Phytochemical study: to fractionate, isolate and characterizate of the chemical (s) marker (s) of the HE from the leaves of K. brasiliensis; ii. To Developed validate of analytical method by High Performance Liquid Chromatography (HPLC)-diode array detector (DAD) to quantify the chemical (s) marker (s) of the EH. i. The EH 50% was prepared by turbo extraction method. It was then submitted to liquid-liquid partition, obtaining dichloromethane, n-butanol and ethyl acetate (AcOEt) fractions. The AcOEt fraction was selected to continue the fractionation process, because it has a chemical profile rich in flavonoids. The acOEt fraction was submitted to column chromatography using different systems for obtaining the compound Kb1. To identify this compound, it was submitted to UV analysis ii. For quantitative analysis, the EH was analyzed by HPLC, using different methods. After selecting the most appropriate method, which showed satisfactory resolution and symmetrical peaks, it was validated according to parameters in the RE 899/2003. As result, it was obtained from the AcOEt fraction the compound Kb1 (2.7 mg). Until this moment, the basic nucleus was characterized by UV analysis using shift reagents. The partial chemical structure of the compound Kb1 was identified as a flavonol, containing hydroxyls in 3 , 4 position (ring A), 5 and 7 free (ring B) and a replacement of the C3 hydroxyl by a sugar. As the analysis were performed in the HPLC coupled to a DAD, we observed that the UV spectrum of the major peaks of EH from K. brasiliensis shown similar UV spectrum. According to the literature, it has been reported the presence of patuletin glycosydes derivatives in the leaves of this species. Therefore, it is suggested that the compound Kb1 is glycosylated patuletin derivative. Probably the sugar (s) unit(s) are linked in the C3 in the C ring. . Regarding the development of HPLC analytical method, the system used consists of phase A: water: formic acid (99,7:0,3, v / v) and phase B: methanol: formic acid (99,7:0,3, v / v), elution gradient of 40% B - 58% B in 50 minutes, ccolumn (Hichrom ®) C18 (250x4, 0 mm, 5 μm), flow rate 0.8 mL / min, UV detection at 370 nm, temperature 25 ° C. In the analysis performed with the co-injection of thecompound Kb1 + HE of K. brasiliensis was observed that it is one of the major compounds with a retention time of 12.47 minutes and had a content of 15.3% in EH of leaves from K. brasiliensis. The method proved to be linear, precise, accurate and reproducible. According to these results, it was observed that compound Kb1 can be used as a chemical marker of EH from leaves of K. brasiliensis, to assist in quality control of drug plant and its derivatives
Resumo:
Desenvolveu-se um método rápido para extração de DNA de bactérias, que ao contrário de outros métodos, não requer o uso de enzimas, como lisozima e proteinase K, previamente, utilizado-se o carbonato de silício (carborundum) como agente físico para efetuar a quebrar da parede celular da bactéria. Com este método conseguiu-se extrair DNA bacteriano num menor tempo, além de mais rápido, ele mostrou-se mais simples e econômico, quando comparado aos métodos convencionais. O DNA obtido pode ser utilizado para diversas finalidades relacionadas ao DNA de bactérias, obtendo-se uma quantidade razoável de DNA, que varia de 725 µg/mL a 1170 µg/mL por cada 0,1 g de célula bacteriana, com ótima qualidade.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
The extraction with pressurized fluids has become an attractive process for the extraction of essential oils, mainly due the specific characteristics of the fluids near the critical region. This work presents results of the extraction process of the essential oil of Cymbopogon winterianus J. with CO2 under high pressures. The effect of the following variables was evaluated: solvent flow rate (from 0.37 to 1.5 g CO2/min), pressure (66.7 and 75 bar) and temperature (8, 10, 15, 20 and 25 ºC) on the extraction kinetics and the total yield of the process, as well as in the solubility and composition of the C. winterianus essential oil. The experimental apparatus consisted of an extractor of fixed bed and the dynamic method was adopted for the calculation of the oil solubility. Extractions were also accomplished by conventional techniques (steam and organic solvent extraction). The determination and identification of extract composition were done by gas chromatography coupled with a mass spectrometer (GC-MS). The extract composition varied in function of the studied operational conditions and also related to the used extraction method. The main components obtained in the CO2 extraction were elemol, geraniol, citronellol and citronellal. For the steam extraction were the citronellal, citronellol and geraniol and for the organic solvent extraction were the azulene and the hexadecane. The most yield values (2.76%) and oil solubility (2.49x10-2 g oil/ g CO2) were obtained through the CO2 extraction in the operational conditions of T = 10°C, P = 66.7 bar and solvent flow rate 0.85 g CO2/min