128 resultados para equines


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Neutralizing antibodies to EEE (6.7%), WEE (1.2%), ILH (26.6%), MAG (28.2%) and TCM (15.7%) viruses were found in sera of 432 equines of the Brazilian Pantanal, area where undiagnosed horse deaths are frequently observed. A 4-fold rise in CF titer to EEE virus was detected in acute and convalescent sera of an encephalitis horse sacrified in 1992. Antibodies to EEE, ILH, MAG and TCM viruses were detected in horses less than 2 years old indicating recent circulation of these viruses in the Pantanal. The evidence of recent equine encephalitis associated with rising CF titer to EEE warrants a more intensive study with attempts to isolate virus from horses with clinical manifestations of encephalitis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Equines are susceptible to respiratory viruses such as influenza and parainfluenza. Respiratory diseases have adversely impacted economies all over the world. This study was intended to determine the presence of influenza and parainfluenza viruses in unvaccinated horses from some regions of the state of São Paulo, Brazil. Blood serum collected from 72 equines of different towns in this state was tested by hemagglutination inhibition test to detect antibodies for both viruses using the corresponding antigens. About 98.6% (71) and 97.2% (70) of the equines responded with antibody protective titers (≥ 80 HIU/25µL) H7N7 and H3N8 subtypes of influenza A viruses, respectively. All horses (72) also responded with protective titers (≥ 80) HIU/25µL against the parainfluenza virus. The difference between mean antibody titers to H7N7 and H3N8 subtypes of influenza A viruses was not statistically significant (p > 0.05). The mean titers for influenza and parainfluenza viruses, on the other hand, showed a statistically significant difference (p < 0.001). These results indicate a better antibody response from equines to parainfluenza 3 virus than to the equine influenza viruses. No statistically significant differences in the responses against H7N7 and H3N8 subtypes of influenza A and parainfluenza 3 viruses were observed according to the gender (female, male) or the age (≤ 2 to 20 years-old) groups. This study provides evidence of the concomitant presence of two subtypes of the equine influenza A (H7N7 and H3N8) viruses and the parainfluenza 3 virus in equines in Brazil. Thus, it is advisable to vaccinate equines against these respiratory viruses.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The prevalence of antibodies against Equine Influenza Virus (EIV) was determined in 529 equines living on ranches in the municipality of Poconé, Pantanal area of Brazil, by means of the hemagglutination inhibition test, using subtype H3N8 as antigen. The distribution and possible association among positive animal and ranches were evaluated by the chi-square test, spatial autoregressive and multiple linear regression models. The prevalence of antibodies against EIV was estimated at 45.2% (95% CI 30.2 - 61.1%) with titers ranging from 20 to 1,280 HAU. Seropositive equines were found on 92.0% of the surveyed ranches. Equine from non-flooded ranches (66.5%) and negativity in equine infectious anemia virus (EIAV) (61.7%) were associated with antibodies against EIV. No spatial correlation was found among the ranches, but the ones located in non-flooded areas were associated with antibodies against EIV. A negative correlation was found between the prevalence of antibodies against EIV and the presence of EIAV positive animals on the ranches. The high prevalence of antibodies against EIV detected in this study suggests that the virus is circulating among the animals, and this statistical analysis indicates that the movement and aggregation of animals are factors associated to the transmission of the virus in the region.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: Rabies is an acute disease of the central nervous system and is responsible for the deaths of thousands of humans, wild animals and livestock, particularly cattle, as well as causing major economic losses. This study describes the genetic characterization of rabies virus variants that circulate in Desmodus rotundus populations and are transmitted to herbivores. METHODS: Fifty rabies virus isolates from bovines and equines in the States of São Paulo and Minas Gerais, Brazil, were genetically characterized and compared with sequences retrieved from GenBank. RESULTS: Two clusters (I and II) with mean nucleotide identities of 99.1 and 97.6% were found. The first of these contained nearly all the samples analyzed. Lineages from other Brazilian states grouped in cluster II. CONCLUSIONS: Analysis of the amino acid sequences of the N proteins revealed the existence of genetic markers that may indicate possible variations between geographic regions, although the biologically active regions are conserved within the species over space and time.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In an endemic area of cutaneous leishmaniasis in Rio de Janeiro State where a mule had been found infected, a systematic search among equines was performed, resulting in the detection of Leishmania parasites in skin lesions of 30.8% of the animals, which included horses and mules. The eventual role of equines in the epidemiology of the human disease is being investigated.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

St. Louis encephalitis virus (SLEV) and West Nile virus (WNV) present ecological and antigenic similarities and are responsible for serious human diseases. In addition, WNV is a significant pathogen in terms of equine health. The purpose of our study was to analyse the seroprevalence of SLEV and WNV in equine sera collected in Santa Fe Province, Argentina. The seroprevalence determined using the plaque reduction neutralisation test was 12.2% for SLEV, 16.2% for WNV and 48.6% for a combination of both viruses. These results provide evidence of the co-circulation of SLEV and WNV in equines in Santa Fe.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Front of exercise, the organic systems may suffer water-electrolyte and acid-base imbalances, particularly in the case of blood gases, demonstrating variations from different causes, whether respiratory and/or metabolic. Understanding the physiological adaptations to exercise is essential in the search for the optimum performance. In this way, this study measured the venous blood gases (pO2, pCO2), as well as the oxygen saturation (SatO2) in healthy equines, Arabian horses finalists in 90km endurance races. A total of fourteen Arabian horses were evaluated, nine males and five females, between six and 12 years old, finalists in 90km endurance races. There was a significant reduction in pO2, pCO2 and SatO2 after the exercise, however, the values remained within the normality range, and did not change the athletic performance of the animals, indicating a temporary alteration, assuming thus a character of physiological response to the exercise performed. The equines, finalists in 90 Km endurance races, demonstrated efficient ventilatory process, without any alterations in the athletic performance, being adapted to the type of exercise imposed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O objetivo deste estudo foi o de avaliar uma associação anestésica com e sem a utilização de relaxante muscular não-despolarizante e seu efeito sobre a pressão intra-ocular de eqüinos. Também objetivou-se uma técnica anestésica sem efeitos adversos que possa ser utilizada em procedimentos e cirurgias oftálmicas nesta espécie animal. Para tanto, dezesseis eqüinos foram divididos aleatoriamente em dois grupos de oito animais cada. Os animais do grupo I foram pré-medicados com romifidina, induzidos com tiletamina/zolazepam e a anestesia foi mantida com halotano e vecurônio. Os animais do grupo II receberam a mesma associação anestésica, com exceção do vecurônio. No decorrer do experimento, a pressão intra-ocular, a pressão arterial e a freqüência cardíaca foram avaliadas em diferentes momentos. A associação anestésica composta pela romifidina, tiletamina/ zolazepam e halotano com e sem vecurônio não promoveu alterações estatisticamente significativas na pressão intra-ocular de eqüinos e o seu uso é exeqüível em procedimentos oftálmicos nesta espécie animal.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A total of 24 male and female equines of mixed breed, 10-20 months of age and naturally infected with internal parasites was utilized in a controlled test to evaluate the efficacy of a moxidectin 2% gel formulation at the dosage of 0.4 mg moxidectin per kg of live weight and an ivermectin 1.87% commercial paste formulation at the dosage 0.2 mg ivermectin per kg applied orally Animals were allocated into three groups of eight horses each based on pre-treatment eggs per gram (EPG) counts and treatments were randomized among the groups. One group was kept as untreated controls. One animal in the moxidectin-treated group died before the end of the trial from a cause unrelated to treatment leaving a total of seven animals in this group. Fecal egg counts were performed three times post-treatment and the number of parasites remaining in each animal was determined. Statistical analyses using geometric means were performed at the 1% level of significance. Both moxidectin and ivermectin preparations reduced initial EPG from a mean of 1600 to 0 on Days 5, 7 and at the end of the trial on Day 14. Efficacy percentages of moxidectin and ivermectin against immature and adult nematodes were as follows: Trichostrongylus axel, Parascaris equorum, Strongylus edentatus, S. vulgaris, Triodontophorus spp. and Gyalocephalus capitatus, 100% for both products; Habronema muscae 99.5 and 99.6%, respectively, Strongyloides westeri, 100 and 99.2%, respectively; Oxyuris equi, 99.6 and 100%, respectively; small strongyles, 99.7% for both products. of the latter, the most numerous were: Cylicocyclus insigne, Cylicostephanus longibursatus and Cyathostomum catinatum. No Gasterophilus nasalis were found in horses from either treated group, while two of eight control horses had infections with this parasite. Moxidectin showed greater efficacy (84.9%) than ivermectin (67.8%) against Strongylus vulgaris larvae found in the mesenteric artery aneurisms, but the difference was not statistically significant. Total parasite counts for both treated groups were significantly lower (p<0.01) than in the non-treated group. No significant differences were noted between moxidectin and ivermectin. Efficacy against the 30 nematode species found in this study was very evident for both products. As expected, neither moxidectin nor ivermectin was effective in controlling the tapeworm Anoplocephala perfoliata. No adverse reactions were observed during the experimental period. (C) 1998 Elsevier B.V. B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)