Biomphalaria tenagophila: dominant character of the resistance to Schistosoma mansoni in descendants of crossbreedings between resistant (Taim, RS) and susceptible (Joinville, SC) strains

The aim of the present work was to study parasitological, molecular, and genetic aspects in descendants of crossbreedings between a totally resistant Biomphalaria tenagophila strain (Taim, RS) and another one highly susceptible (Joinville, SC) to Schistosoma mansoni. Descendants F1 and F2 were submitted to S. mansoni infection (LE strain). The susceptibility rates for individuals from Group F1 were 0 to 0.6%, and from Group F2 was 7.2%. The susceptible individuals from Group F2 discharged a lower number of cercariae, when compared with the susceptible parental group, and in 2 out of 9 positive snails the cercarial elimination was discontinued. In order to identify genetic markers associated with resistance the genotype of parental snails and their offspring F1 and F2 were analyzed by means of the randomly amplified polymorphic DNA method. Nevertheless, it was not possible to detect any marker associated to resistance, but the results showed that in the mentioned species the resistance character is determined by two dominant genes.

Possible hybridization of Brazilian planorbid snails and its importance in population dynamics

This study focuses on the possibility of experimental hybridization among host snail species for Schistosoma mansoni in Brazil, with morphological characterization of the hybrids found. By using albinism as a genetic marker, intraspecific crossbreedings were performed between two strains of each species involved, in addition to interspecific crossbreedings; the only viable crossbreeding was between pigmented Biomphalaria glabrata (Paulista, PE) and albino B. tenagophila (Joinville, SC), with the formation of F1 and F2 generations. All offspring in F1 displayed black eyes and a renal ridge on the mantle, while F2 displayed dissociated morphological traits. With regard to reproduction, F1 was more efficient than F2. The experiment's results suggest post-zygotic reproductive isolation.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.