505 resultados para approximala hj
Resumo:
A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.
Resumo:
Three different aspects of the morphological organisation of deep-sea fish retinae are reviewed: First, questions of general cell biological relevance are addressed with respect to the development and proliferation patterns of photoreceptors, and problems associated with the growth of multibank retinae, and with outer segment renewal are discussed in situations where there is no direct contact between the retinal pigment epithelium and the tips of rod outer segments. The second part deals with the neural portion of the deep-sea fish retina. Cell densities are greatly reduced, yet neurohistochemistry demonstrates that all major neurotransmitters and neuropeptides found in other vertebrate retinae are also present in deep-sea fish. Quantitatively, convergence rates in unspecialised parts of the retina are similar to those in nocturnal mammals. The differentiation of horizontal cells makes it unlikely that species with more than a single visual pigment are capable of colour vision. In the third part. the diversity of deep-sea fish retinae is highlighted. Based on the topography of ganglion cells, species are identified with areae or foveae located in various parts of the retina, giving them a greatly improved spatial resolving power in specific parts of their visual fields. The highest degree of specialisation is found in tubular eyes. This is demonstrated in a case study of the scopelarchid retina, where as many as seven regions with different degrees of differentiation can be distinguished, ranging from an area giganto cellularis, regions with grouped rods to retinal diverticulum. (C) 1998 Elsevier Science Ltd. All rights reserved.
Resumo:
An analytical approach to the stress development in the coherent dendritic network during solidification is proposed. Under the assumption that stresses are developed in the network as a result of the friction resisting shrinkage-induced interdendritic fluid flow, the model predicts the stresses in the solid. The calculations reflect the expected effects of postponed dendrite coherency, slower solidification conditions, and variations of eutectic volume fraction and shrinkage. Comparing the calculated stresses to the measured shear strength of equiaxed mushy zones shows that it is possible for the stresses to exceed the strength, thereby resulting in reorientation or collapse of the dendritic network.
Resumo:
Relative eye size, gross brain morphology and central localization of 2-[I-125]iodomelatonin binding sites and melatonin receptor gene expression were compared in six gadiform fish living at different depths in the north-east Atlantic Ocean: Phycis blennoides (capture depth range 265-1260 m), Nezumia aequalis (445-1512 m), Coryphaenoides rupestris (706-1932 m), Trachyrincus murrayi (1010-1884 m), Coryphaenoides guentheri (1030 m) and Coryphaenoides (Nematonurus) armatus (2172-4787 m). Amongst these, the eye size range was 0.15-0.35 of head length with a value of 0.19 for C.(N.) armatus, the deepest species. Brain morphology reflected behavioural differences with well-developed olfactory regions in P.blennoides, T.murrayi and C. (N.) armatus and evidence of olfactory deficit in N. aequalis, C. rupestris and C. guentheri. All species had a clearly defined optic tectum with 2-[I-125] iodomelatonin binding and melatonin receptor gene expression localized to specific brain regions in a similar pattern to that found in shallow-water fish. Melatonin receptors were found throughout the visual structures of the brains of all species. Despite living beyond the depth of penetration of solar light these fish have retained central features associated with the coupling of cycles of growth, behaviour and reproduction to the diel light-dark cycle. How this functions in the deep sea remains enigmatic.
Resumo:
The chondroitin sulfate proteoglycans neurocan and phosphacan are believed to modulate neurite outgrowth by binding to cell adhesion molecules, tenascin, and the differentiation factors heparin-binding growth-associated molecule and amphoterin. To assess the role of these chondroitin sulfate proteoglycans in the olfactory system, we describe here their expression patterns during both embryonic and postnatal development in the mouse. Immunoreactivity for neurocan was first detected in primary olfactory neurons at embryonic day 11.5 (E11.5). Neurocan was expressed by primary olfactory axons as they extended toward the rostral pole of the telencephalon as well as by their arbors in glomeruli after they contacted the olfactory bulb. The role of neurocan was examined by growing olfactory neurons on an extracellular matrix substrate containing neurocan or on extracellular matrix in the presence of soluble neurocan. In both cases, neurocan strongly promoted neurite outgrowth. These results suggest that neurocan supports the growth of primary olfactory axons through the extracellular matrix as they project to the olfactory bulb during development. Phosphacan, unlike neurocan, was present within the mesenchyme surrounding the E11.5 and E12.5 nasal cavity. This expression decreased at E13.5, concomitant with a transient appearance of phosphacan in nerve fascicles. Within the embryonic olfactory bulb, phosphacan was localised to the external and internal plexiform layers. However, during early postnatal development phosphacan was concentrated in the glomerular layer. These results suggest that phosphacan may play a role in delineating the pathway of growing olfactory axons as well as defining the laminar organization of the bulb. Together, the spatiotemporal expression patterns of neurocan and phosphacan indicate that these chondroitin sulfate proteoglycans have diverse in situ roles, which are dependent on context-specific interactions with extracellular and cell adhesion molecules within the developing olfactory nerve pathway. (C) 2000 Wiley-Liss, Inc.
Resumo:
Objective: To determine the factors associated with general practitioners' current practice location, with particular emphasis on rural location. Design: Observational, retrospective, case-control study using a self-administered questionnaire. Setting: Australian general practices in December 2000. Participants: 2414 Australian-trained rural and urban GPs. Main outcome measure: Current urban or rural practice location. Results: For Australia as a whole, rural GPs were more likely to be male (odds ratio [OR], 1.42; 95% CI, 1.17-1.73), Australian-born (OR, 1.95; 95% CI, 1.55-2.45), and to report attending a rural primary school for some (OR, 2.21; 95% CI, 1.69-2.89) or all (OR, 2.79; 95% CI, 1.94-4.00) of their primary schooling. Rural GPs' partners or spouses were also more likely to report some (OR, 2.75; 95% CI, 2.07-3.66) or all (OR, 2.86; 95% CI, 2.02-4.05) rural primary schooling. A rural background in both GP and partner produced the highest likelihood of rural practice (OR, 6.28; 95% CI, 4.26-9.25). For individual jurisdictions, a trend towards more rural GPs being men was only significant in Tasmania. In all jurisdictions except Tasmania and the Northern Territory, rural GPs were more likely to be Australian-born. Conclusions: GPs' and their partners' rural background (residence and primary and secondary schooling) influences choice of practice location, with partners' background appearing to exert more influence.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Aneas I, Rodrigues MV, Pauletti BA, Silva GJ, Carmona R, Cardoso L, Kwitek AE, Jacob HJ, Soler JM, Krieger JE. Congenic strains provide evidence that four mapped loci in chromosomes 2, 4, and 16 influence hypertension in the SHR. Physiol Genomics 37: 52-57, 2009. First published January 6, 2009; doi: 10.1152/physiolgenomics.90299.2008. - To dissect the genetic architecture controlling blood pressure (BP) regulation in the spontaneously hypertensive rat (SHR) we derived congenic rat strains for four previously mapped BP quantitative trait loci (QTLs) in chromosomes 2, 4, and 16. Target chromosomal regions from the Brown Norway rat (BN) averaging 13 - 29 cM were introgressed by marker-assisted breeding onto the SHR genome in 12 or 13 generations. Under normal salt intake, QTLs on chromosomes 2a, 2c, and 4 were associated with significant changes in systolic BP (13, 20, and 15 mmHg, respectively), whereas the QTL on chromosome 16 had no measurable effect. On high salt intake (1% NaCl in drinking water for 2 wk), the chromosome 16 QTL had a marked impact on SBP, as did the QTLs on chromosome 2a and 2c (18, 17, and 19 mmHg, respectively), but not the QTL on chromosome 4. Thus these four QTLs affected BP phenotypes differently: 1) in the presence of high salt intake (chromosome 16), 2) only associated with normal salt intake (chromosome 4), and 3) regardless of salt intake (chromosome 2c and 2a). Moreover, salt sensitivity was abrogated in congenics SHR. BN2a and SHR. BN16. Finally, we provide evidence for the influence of genetic background on the expression of the mapped QTLs individually or as a group. Collectively, these data reveal previously unsuspected nuances of the physiological roles of each of the four mapped BP QTLs in the SHR under basal and/or salt loading conditions unforeseen by the analysis of the F2 cross.
Resumo:
The neuropathological changes associated with Huntington's disease (HD) are most marked in the head of the caudate nucleus and, to a lesser extent, in the putamen and globus pallidus, suggesting that at least part of the language impairments found in patients with HD may result from non-thalamic subcortical (NTS) pathology. The present study aimed to test the hypothesis that a signature profile of impaired language functions is found in patients who have sustained damage to the non-thalamic subcortex, either focally induced or resulting from neurodegenerative pathology. The language abilities of a group of patients with Huntington's disease (n=13) were compared with those of an age- and education-matched group of patients with chronic NTS lesions following stroke (n=13) and a non-neurologically impaired control group (n=13). The three groups were compared on language tasks that assessed both primary and more complex language abilities. The primary language battery consisted of The Western Aphasia Battery and The Boston Naming Test, whilst the more complex cognitive-linguistic battery employed selected subtests from The Test of Language Competence-Expanded, The Test of Word Knowledge and The Word Test-Revised. On many of the tests of primary language function from the Western Aphasia Battery, both the HD and NTS participants performed in a similar manner to the control participants. The language performances of the HD participants were significantly more impaired (p<0.05 using modified Bonferroni adjustments) than the control group, however, on various lexico-semantic tasks (e. g. the Boston Naming Test and providing definitions), on both single-word and sentence-level generative tasks (e. g. category fluency and formulating sentences), and on tasks which required interpretation of ambiguous, figurative and inferential meaning. The difficulties that patients with HD experienced with tasks assessing complex language abilities were strikingly similar, both qualitatively and quantitatively, to the language profile produced by NTS participants. The results provide evidence to suggest that a signature language profile is associated with damage to the non-thalamic subcortex resulting from either focal neurological insult or a degenerative disease.
Resumo:
The neurexins are a large family of neuronal cell-surface proteins believed to be involved in intercellular signalling and the formation of intercellular junctions. To begin to assess the role of these proteins in the olfactory bulb, we describe here the expression patterns of their transmembrane and secreted ligands, the neuroligins and neurexophilins, during both embryonic and postnatal development. In situ hybridisation showed that neuroligin 1 and 2 were expressed by second order mitral cells during early postnatal development but not in adults. The secreted ligand for a-neurexin, neurexophilin 1, was also expressed in the postnatal olfactory bulb. Neurexophilin 1 was detected in only periglomerular cells during the early postnatal period of glomerular formation but later was also expressed in mitral cells. These results suggest that neurexin-ligand interactions may be important for development and/or maturation of synaptic connections in the primary olfactory pathway.
Resumo:
Each primary olfactory neuron stochastically expresses one of similar to1000 odorant receptors. The total population of these neurons therefore consists of similar to1,000 distinct subpopulations, each of which are mosaically dispersed throughout one of four semi-annular zones in the nasal cavity. The axons of these different subpopulations are initially intermingled within the olfactory nerve. However, upon reaching the olfactory bulb, they sort out and converge so that axons expressing the same odorant receptor typically target one or two glomeruli. The spatial location of each of these 1800 glomeruli are topographically-fixed in the olfactory bulb and are invariant from animal to animal. Thus, while odorant receptors are expressed mosaically by neurons throughout the olfactory neuroepithelium their axons sort out, converge and target the same glomerulus within the olfactory bulb. How is such precise and reproducible topographic targeting generated? While some of the mechanisms governing the growth cone guidance of olfactory sensory neurons are understood, the cues responsible for homing axons to their target site remain elusive.
Resumo:
Children with developmental coordination disorder (DCD) experience difficulty participating in the typical activities of childhood and are known to have a more sedentary pattern of activities than their peers. Little research has been done to investigate the impact of these deficits on the lives of children with DCD and the importance of their participation in the typical activities of childhood. This qualitative study explored the impact of the disorder and the importance of participation for children with DCD from the perspective of the parent. Twelve in-depth interviews were conducted with parents of children with DCD who attended a university clinic specializing in using the Cognitive Orientation to daily Occupational Performance (COOP) approach, a cognitive-based intervention. Findings revealed that incompetence in everyday activities had serious negative effects for the children. Conversely, intervention that was focused on enablement at the activity and participation level had a significant positive impact on the children's quality of life. Emerging themes highlighted the notion that performance competency played an important role in being accepted by peers and being able to be part of the group. As well, parents reported that successful participation built confidence in their children and allowed them to try other new activities. The World Health Organization's International Classification of Functioning, Disability, and Health provides a unique framework for analyzing and understanding the impact of the physical disability on the lives of families with children with DCD. Results illustrate how intervention that focuses on enabling children to choose their own functional goals in the area of physical activity has important implications for enabling participation and building the social networks of children with DCD. (C) 2003 Elsevier B.V. All rights reserved.