939 resultados para X-ray techniques
Resumo:
The thesis is dedicated to the implementation of advanced x-ray-based techniques for the investigation of the battery systems, more predominantly, the cathode materials. The implemented characterisation methods include synchrotron based x-ray absorption spectroscopy, powder x-ray diffraction, 2-dimensional x-ray fluorescence, full field transmission soft x-ray microscopy, and laboratory x-ray photoelectron spectroscopy. The research highlights the different areas of expertise for each described method, in terms of material characterisation, exploring their complementarities and intersections. The results are focused over manganese hexacyanoferrate and partially Ni substituted manganese hexacyanoferrate, through both organic and aqueous battery systems. In aqueous system, the modification of cathode composition has been observed with various techniques, indicating to the processes occurring in bulk, surface, locally or in long-range, including with the speciation by 2-dimensional scanning, and the time-resolution, by the implementation of the operando measurements. In organic media, the inhomogenisation of the cathode material during the aging process was investigated by the development of the special image treatment procedure for the maps, obtained from the transmission soft x-ray microscopy. It worth mentioning, that apart from the combination of the outcomes from the various x-ray measurements, the exploration of the new capabilities was also conducted, namely, probing the oxidation state of the element with the synchrotron-based 2-dimensional x-ray fluorescence technique, which, generally, with conventional set up, is not possible to achieve. The results and methodology from this thesis can, of course, be generalised on the characterisation of the other battery systems, and not only, as the x-ray techniques are one of the most informative and sophisticated methods for advanced structural investigation of the materials.
Resumo:
Recently, modern cross-sectional imaging techniques such as multi-detector computed tomography (MDCT) have pioneered post mortem investigations, especially in forensic medicine. Such approaches can also be used to investigate bones non-invasively for anthropological purposes. Long bones are often examined in forensic cases because they are frequently discovered and transferred to medico-legal departments for investigation. To estimate their age, the trabecular structure must be examined. This study aimed to compare the performance of MDCT with conventional X-rays to investigate the trabecular structure of long bones. Fifty-two dry bones (24 humeri and 28 femora) from anthropological collections were first examined by conventional X-ray, and then by MDCT. Trabecular structure was evaluated by seven observers (two experienced and five inexperienced in anthropology) who analyzed images obtained by radiological methods. Analyses contained the measurement of one quantitative parameter (caput diameter of humerus and femur) and staging the trabecular structure of each bone. Preciseness of each technique was indicated by describing areas of trabecular destruction and particularities of the bones, such as pathological changes. Concerning quantitative parameters, the measurements demonstrate comparable results for the MDCT and conventional X-ray techniques. In contrast, the overall inter-observer reliability of the staging was low with MDCT and conventional X-ray. Reliability increased significantly when only the results of the staging performed by the two experienced observers were compared, particularly regarding the MDCT analysis. Our results also indicate that MDCT appears to be better suited to a detailed examination of the trabecular structure. In our opinion, MDCT is an adequate tool with which to examine the trabecular structure of long bones. However, adequate methods should be developed or existing methods should be adapted to MDCT.
Resumo:
The crystallization of well-defined poly(L-lactide)-b-poly(epsilon-caprolactone) diblock copolymers, PLLA-b-PCL, was investigated by time-resolved X-ray techniques, polarized optical microscopy (POM), and differential scanning calorimetry (DSC). Two compositions were studied that contained 44 and 60 wt % poly(L-lactide), PLLA (they are referred to as (L44C5614)-C-11 and (L60C409)-C-12, respectively, with the molecular weight of each block in kg/mol as superscript). The copolymers were found to be initially miscible in the melt according to small-angle X-ray scattering measurements (SAXS). Their thermal behavior was also indicative of samples whose crystallization proceeds from a mixed melt. Sequential isothermal crystallization from the melt at 100 degreesC (for 30 min) and then at 30 degreesC (for 15 min) was measured. At 100 degreesC only the PLLA block is capable of crystallization, and its crystallization kinetics was followed by both WAXS and DSC; comparable results were obtained that indicated an instantaneous nucleation with three-dimensional superstructures (Avrami index of approximately 3). The spherulitic nature of the superstructure was confirmed by POM. When the temperature was decreased to 30 degreesC, the PCL block was able to crystallize within the PLLA negative spherulites (with an Avrami index of 2, as opposed to 3 in homo-PCL), and its crystallization rate was much slower than an equivalent homo-PCL. Time-resolved SAXS experiments in (L60C409)-C-12 revealed an initial melt mixed morphology at 165 degreesC that upon cooling transformed into a transient microphase-separated lamellar structure prior to crystallization at 100 degreesC.
Resumo:
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Resumo:
The rational design of new heterogeneous catalysts for clean chemical technologies can be accelerated by molecular level insight into surface chemical processes. In situ methodologies, able to provide time-resolved and/or pressure dependent information on the evolution of reacting adsorbed layers over catalytically relevant surfaces, are therefore of especial interest. Here we discuss recent applications of surface X-ray techniques to surface-catalysed oxidations, (de)hydrogenations, C-C coupling, dehalogenation and associated catalyst restructuring, and explore how these may help to shape future sustainable chemistry. © 2010 The Royal Society of Chemistry.
Resumo:
The solubility of penciclovir (C10N5O3H17) in a novel film formulation designed for the treatment of cold sores was determined using X-ray, thermal, microscopic and release rate techniques. Solubilities of 0.15–0.23, 0.44, 0.53 and 0.42% (w/w) resulted for each procedure. Linear calibration lines were achieved for experimentally and theoretically determined differential scanning calorimetry (DSC) and X-ray powder diffractometry (XRPD) data. Intra- and inter-batch data precision values were determined; intra values were more precise. Microscopy was additionally useful for examining crystal shape, size distribution and homogeneity of drug distribution within the film. Whereas DSC also determined melting point, XRPD identified polymorphs and release data provided relevant kinetics.
Resumo:
The combination of x-ray absorption spectroscopy (XAS) with UV-Vis and Raman spectroscopies or with Differential Scanning Calorimetry (DSC) has been recently carried out on the D44 beamline of DCI-LURE. The different set-ups used to perform such combinations are described and examples of combined investigations belonging to different field of materials science (coordination chemistry, sol-gel and catalysis) are presented. © Physica Scripta 2005.
Resumo:
In recent years, several studies have shown that concentrations of trace elements are altered in neoplastic breast tissues. However, the microenvironment and metabolic changes caused by tumors are complex and still not completely understood. Under this aspect, the combination of different techniques to investigate the role of trace elements in promoting and/or maintaining a tumor is interesting once the combination of information obtained by analytical techniques and immunohistochemical assays, associated with clinicopathological data, may allow a better metabolic understanding of trace elements in breast cancer. In this work, the role of the trace elements Ca, Fe, Cu and Zn in neoplastic breast tissues was investigated by X-ray fluorescence (XRF) techniques and immunohistochemical assays. We determined concentrations of Ca, Fe, Cu and Zn in normal and neoplastic breast tissues using energy dispersive XRF, and these values were used to set the positive or negative expression of elements in normal and neoplastic tissues. These expressions were correlated with the spatial distributions of trace elements (evaluated by micro-XRF) and with immunoexpression of matrix metalloproteinases (MMPs), tissue inhibitors of MMPs and vascular endothelial growth factor. The results revealed that the expression of the trace elements Fe, Cu and vascular endothelial growth factor are related, indicating that higher levels of these elements can be associated with the angiogenic process in breast cancer. Also, associations between Ca, Zn and MMPs expression have been observed, possibly because of the fact that both metals are present in these proteins. © 2013 John Wiley & Sons, Ltd.
Resumo:
ABSTRACT: The present work uses multivariate statistical analysis as a form of establishing the main sources of error in the Quantitative Phase Analysis (QPA) using the Rietveld method. The quantitative determination of crystalline phases using x ray powder diffraction is a complex measurement process whose results are influenced by several factors. Ternary mixtures of Al2O3, MgO and NiO were prepared under controlled conditions and the diffractions were obtained using the Bragg-Brentano geometric arrangement. It was possible to establish four sources of critical variations: the experimental absorption and the scale factor of NiO, which is the phase with the greatest linear absorption coefficient of the ternary mixture; the instrumental characteristics represented by mechanical errors of the goniometer and sample displacement; the other two phases (Al2O3 and MgO); and the temperature and relative humidity of the air in the laboratory. The error sources excessively impair the QPA with the Rietveld method. Therefore it becomes necessary to control them during the measurement procedure.
Resumo:
Solid lipid nanoparticles (SLN) without drug and SLN loaded with chloroaluminum phthalocyanine (AlClPc) were prepared by solvent diffusion method in aqueous system and characterized by thermal analyses and X-ray diffraction (XRD) in this study. Determination of particle size, zeta potential (ZP), and encapsulation efficiency were also evaluated. SLN containing AlClPc of nanometer size with high encapsulation efficiency and ZP were obtained. The results indicated that the size of SLN loaded with AlClPc is larger than that of the inert particle, but ZP is not changed significantly with incorporation of the drug. In differential scanning calorimetry (DSC) curves, it was observed that the melting point of stearic acid (SA) isolated and in SLN occurred at 55 and 64 degrees C, respectively, suggesting the presence of different polymorphs. DSC also shows that the crystallinity state of SLN was much less than that of SA isolated. The incorporation of drug in SLN may have been favored by this lower crystallinity degree of the samples. XRD techniques corroborated with the thermal analytic techniques, suggesting the polymorphic modifications of stearic acid.
Resumo:
The combination of scaled analogue experiments, material mechanics, X-ray computed tomography (XRCT) and Digital Volume Correlation techniques (DVC) is a powerful new tool not only to examine the 3 dimensional structure and kinematic evolution of complex deformation structures in scaled analogue experiments, but also to fully quantify their spatial strain distribution and complete strain history. Digital image correlation (DIC) is an important advance in quantitative physical modelling and helps to understand non-linear deformation processes. Optical non-intrusive (DIC) techniques enable the quantification of localised and distributed deformation in analogue experiments based either on images taken through transparent sidewalls (2D DIC) or on surface views (3D DIC). X-ray computed tomography (XRCT) analysis permits the non-destructive visualisation of the internal structure and kinematic evolution of scaled analogue experiments simulating tectonic evolution of complex geological structures. The combination of XRCT sectional image data of analogue experiments with 2D DIC only allows quantification of 2D displacement and strain components in section direction. This completely omits the potential of CT experiments for full 3D strain analysis of complex, non-cylindrical deformation structures. In this study, we apply digital volume correlation (DVC) techniques on XRCT scan data of “solid” analogue experiments to fully quantify the internal displacement and strain in 3 dimensions over time. Our first results indicate that the application of DVC techniques on XRCT volume data can successfully be used to quantify the 3D spatial and temporal strain patterns inside analogue experiments. We demonstrate the potential of combining DVC techniques and XRCT volume imaging for 3D strain analysis of a contractional experiment simulating the development of a non-cylindrical pop-up structure. Furthermore, we discuss various options for optimisation of granular materials, pattern generation, and data acquisition for increased resolution and accuracy of the strain results. Three-dimensional strain analysis of analogue models is of particular interest for geological and seismic interpretations of complex, non-cylindrical geological structures. The volume strain data enable the analysis of the large-scale and small-scale strain history of geological structures.
Resumo:
Deep geological storage of radioactive waste foresees cementitious materials as reinforcement of tunnels and as backfill. Bentonite is proposed to enclose spent fuel canisters and as drift seals. Sand/bentonite (s/b) is foreseen as backfill material of access galleries or as drift seals. The emplacement of cementitious material next to clay material generates an enormous chemical gradient in pore-water composition that drives diffusive solute transport. Laboratory studies and reactive transport modeling predicted significant mineral alteration at and near interfaces, mainly resulting in a decrease of porosity in bentonite. The goal of this thesis was to characterize and quantify the cement/bentonite interactions both spatially and temporally in laboratory experiments. A newly developed mobile X-ray transparent core infiltration device was used to perform X-ray computed tomography (CT) scans without interruption of running experiments. CT scans allowed tracking the evolution of the reaction plume and changes in core volume/diameter/density during the experiments. In total 4 core infiltration experiments were carried out for this study with the compacted and saturated cores consisting of MX-80 bentonite and sand/MX-80 bentonite mixture (s/b; 65/35%). Two different high-pH cementitious pore-fluids were infiltrated: a young (early) ordinary Portland cement pore-fluid (APWOPC; K+–Na+–OH-; pH 13.4; ionic strength 0.28 mol/kg) and a young ‘low-pH’ ESDRED shotcrete pore-fluid (APWESDRED; Ca2+–Na+–K+–formate; pH 11.4; ionic strength 0.11 mol/kg). The experiments lasted between 1 and 2 years. In both bentonite experiments, the hydraulic conductivity was strongly reduced after switching to high-pH fluids, changing eventually from an advective to a diffusion-dominated transport regime. The reduction was mainly induced by mineral precipitation and possibly partly also by high ionic strength pore-fluids. Both bentonite cores showed a volume reduction and a resulting transient flow in which pore-water was squeezed out during high-pH infiltration. The outflow chemistry was characterized by a high ionic strength, while chloride in the initial pore water got replaced as main anionic charge carrier by sulfate, originating from gypsum dissolution. The chemistry of the high-pH fluids got strongly buffered by the bentonite, consuming hydroxide and in case of APWESDRED also formate. Hydroxide got consumed by mineral reactions (saponite and possibly talc and brucite precipitation), while formate being affected by bacterial degradation. Post-mortem analysis showed reaction zones near the inlet of the bentonite core, characterized by calcium and magnesium enrichment, consisting predominately of calcite and saponite, respectively. Silica got enriched in the outflow, indicating dissolution of silicate-minerals, identified as preferentially cristobalite. In s/b, infiltration of APWOPC reduced the hydraulic conductivity strongly, while APWESDRED infiltration had no effect. The reduction was mainly induced by mineral precipitation and probably partly also by high ionic strength pore-fluids. Not clear is why the observed mineral precipitates in the APWESDRED experiment had no effect on the fluid flow. Both s/b cores showed a volume expansion along with decreasing ionic strengths of the outflow, due to mineral reactions or in case of APWESDRED infiltration also mediated by microbiological activity, consuming hydroxide and formate, respectively. The chemistry of the high-pH fluids got strongly buffered by the s/b. In the case of APWESDRED infiltration, formate reached the outflow only for a short time, followed by enrichment in acetate, indicating most likely biological activity. This was in agreement to post-mortem analysis of the core, observing black spots on the inflow surface, while the sample had a rotten-egg smell indicative of some sulfate reduction. Post-mortem analysis showed further in both cores a Ca-enrichment in the first 10 mm of the core due to calcite precipitation. Mg-enrichment was only observed in the APWOPC experiment, originating from newly formed saponite. Silica got enriched in the outflow of both experiments, indicating dissolution of silicate-minerals, identified in the OPC experiment as cristobalite. The experiments attested an effective buffering capacity for bentonite and s/b, a progressing coupled hydraulic-chemical sealing process and also the preservation of the physical integrity of the interface region in this setup with a total pressure boundary condition on the core sample. No complete pore-clogging was observed but the hydraulic conductivity got rather strongly reduced in 3 experiments, explained by clogging of the intergranular porosity (macroporosity). Such a drop in hydraulic conductivity may impact the saturation time of the buffer in a nuclear waste repository, although the processes and geometry will be more complex in repository situation.