Preparation and characterization of chloroaluminum phthalocyanine-loaded solid lipid nanoparticles by thermal analysis and powder X-ray diffraction techniques

Solid lipid nanoparticles (SLN) without drug and SLN loaded with chloroaluminum phthalocyanine (AlClPc) were prepared by solvent diffusion method in aqueous system and characterized by thermal analyses and X-ray diffraction (XRD) in this study. Determination of particle size, zeta potential (ZP), and encapsulation efficiency were also evaluated. SLN containing AlClPc of nanometer size with high encapsulation efficiency and ZP were obtained. The results indicated that the size of SLN loaded with AlClPc is larger than that of the inert particle, but ZP is not changed significantly with incorporation of the drug. In differential scanning calorimetry (DSC) curves, it was observed that the melting point of stearic acid (SA) isolated and in SLN occurred at 55 and 64 degrees C, respectively, suggesting the presence of different polymorphs. DSC also shows that the crystallinity state of SLN was much less than that of SA isolated. The incorporation of drug in SLN may have been favored by this lower crystallinity degree of the samples. XRD techniques corroborated with the thermal analytic techniques, suggesting the polymorphic modifications of stearic acid.

In-situ X-ray diffraction studies during growth of Ni-Ti shape memory alloy films and their complementary ex-situ characterization

Shape Memory Alloy (SMA) Ni-Ti films have attracted much interest as functional and smart materials due to their unique properties. However, there are still important issues unresolved like formation of film texture and its control as well as substrate effects. Thus, the main challenge is not only the control of the microstructure, including stoichiometry and precipitates, but also the identification and control of the preferential orientation since it is a crucial factor in determining the shape memory behaviour. The aim of this PhD thesis is to study the optimisation of the deposition conditions of films of Ni-Ti in order to obtain the material fully crystallized at the end of the deposition, and to establish a clear relationship between the substrates and texture development. In order to achieve this objective, a two-magnetron sputter deposition chamber has been used allowing to heat and to apply a bias voltage to the substrate. It can be mounted into the six-circle diffractometer of the Rossendorf Beamline (ROBL) at the European Synchrotron Radiation Facility (ESRF), Grenoble, France, enabling an in-situ characterization by X-ray diffraction(XRD) of the films during their growth and annealing. The in-situ studies enable us to identify the different steps of the structural evolution during deposition with a set of parameters as well as to evaluate the effect of changing parameters on the structural characteristics of the deposited film. Besides the in-situ studies, other complementary ex-situ characterization techniques such as XRD at a laboratory source, Rutherford backscattering spectroscopy(RBS), Auger electron spectroscopy (AES), cross-sectional transmission electron microscopy (X-TEM), scanning electron microscopy (SEM), and electrical resistivity (ER) measurements during temperature cycling have been used for a fine structural characterization. In this study, mainly naturally and thermally oxidized Si(100) substrates, TiN buffer layers with different thicknesses (i.e. the TiN topmost layer crystallographic orientation is thickness dependent) and MgO(100) single crystals were used as substrates. The chosen experimental procedure led to a controlled composition and preferential orientation of the films. The type of substrate plays an important role for the texture of the sputtered Ni-Ti films and according to the ER results, the distinct crystallographic orientations of the Ni-Ti films influence their phase transformation characteristics.

Nanoporous materials: pillared clays and regular silicas as an example of synthesis and their porosity characterization by X-ray diffraction

Because of their practical applications, porous materials attract the attention of undergraduate students in a way that can be used to teach techniques and concepts in various chemistry disciplines. Porous materials are studied in various chemistry disciplines, including inorganic, organic, and physical chemistry. In this work, the syntheses of a microporous material and a mesoporous material are presented. The porosity of the synthesized materials is characterized by X-ray diffraction analysis. We show that this technique can be used to determine the pore dimensions of the synthesized materials.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Crystallization and preliminary X-ray diffraction analysis of a Lys49-phospholipase A(2) complexed with caffeic acid, a molecule with inhibitory properties against snake venoms

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Crystallization and preliminary X-ray diffraction analysis of three myotoxic phospholipases A2 from Bothrops brazili venom

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

X-ray photoelectron spectroscopy, x-ray absorption spectroscopy, and x-ray diffraction characterization of CuO-TiO2-CeO2 catalyst system

X-ray photoelectron spectroscopy (XPS), x-ray diffraction (XRD), and x-ray absorption spectroscopy (XAS) techniques have been applied to characterize the surface composition and structure of a series of CuO-TiO2-CeO2 catalysts. For a small loading of cerium, ceria was mainly dispersed on the titania surface and a minor amount of CeO2 crystallite appeared. At higher loading of cerium, the CeO2 phase increased and the atomic Ce/Ti ratio values were smaller than the nominal composition, as a consequence of cerium agglomeration. This result suggests that only a fraction of cerium can be spread on the titania surface. For titanium-based mixed oxide, we observed that cerium is found as Ce3+ uniquely on the surface. The atomic Cu/(Ce+Ti) ratio values showed no influence from cerium concentration on the dispersion of copper, although the copper on the surface was shown to be dependent on the cerium species. For samples with a high amount of cerium, XPS analysis indicated the raise of second titanium species due cerium with spin-orbit components at higher binding energies than those presented by Ti4+ in a tetragonal structure. The structural results obtained by XAS are consistent with those obtained by XRD and XPS. (C) 2001 American Vacuum Society.

Crystallization, preliminary X-ray diffraction analysis and Patterson search of oxyhaemoglobin I from the wolf (Chrysocyon brachiurus)

Oxyhaemoglobin I isolated from the Brazilian wolf Chrysocyon brachiurus has been crystallized and X-ray diffraction data has been collected to 2.06 A resolution using a synchrotron-radiation source. Crystals were determined to belong to the space group P2(1)2(1)2(1) and preliminary structural analysis revealed the presence of one tetramer in the asymmetric unit. The structure was determined using standard molecular-replacement techniques and is currently being refined using maximum-likelihood protocols. This is the first haemoglobin isolated from a member of the Canidae family to be crystallized and it will provide further insights in the comparative biochemistry of vertebrate haemoglobins.

Grazing incidence X-ray diffraction and atomic force microscopy analysis of BaBi2Ta2O9 thin films

Thin films of BaBi2Ta2O9 (BBT) composition were prepared through the metal organic decomposition method. The crystallinity, phase formation, crystallite size and morphology of the thin films were measured as a function of the type of substrate, stoichiometry of solution and process variables such as thickness and temperature. The thin films were investigated by grazing incidence X-ray diffractometry and atomic force microscopy (AFM) techniques. For the sample without excess of bismuth, diffraction peaks other than that of the BBT phase were observed. A well crystallized BBT single phase was observed for films prepared from a solution with 10% excess of bismuth, deposited on Si/Pt substrate, with a thickness up to 150 nm and sintered at temperatures of 700 degreesC. The thin BBT phase films heat-treated at 600 degreesC presented a diffraction pattern characteristic of samples with lower degree of crystallinity whereas for the thin films heat-treated at 800 degreesC, we observed the presence of other phases than the BBT. For the thin film deposited on the Sin+ substrate, we observe that the peaks corresponding to the BBT phase are broader than that observed on the samples deposited on the Pt and Si/Pt substrates. No variation of average crystallite size was observed as the excess of Bi increased from 10 to 20%. AFM images for the samples showed that the increasing the amount of bismuth promotes grain growth. The average surface roughness measured was in the range of 16-22 nm showing that the bismuth amount had no or little effect on the roughness of films. (C) 2002 Elsevier B.V. B.V. All rights reserved.

Crystallization and preliminary X-ray diffraction analysis of three myotoxic phospholipases A2 from Bothrops brazili venom

Two myotoxic and noncatalytic Lys49-phospholipases A2 (braziliantoxin-II and MT-II) and a myotoxic and catalytic phospholipase A2 (braziliantoxin-III) from the venom of the Amazonian snake Bothrops brazili were crystallized. The crystals diffracted to resolutions in the range 2.562.05 angstrom and belonged to space groups P3121 (braziliantoxin-II), P6522 (braziliantoxin-III) and P21 (MT-II). The structures were solved by molecular-replacement techniques. Both of the Lys49-phospholipases A2 (braziliantoxin-II and MT-II) contained a dimer in the asymmetric unit, while the Asp49-phospholipase A2 braziliantoxin-III contained a monomer in its asymmetric unit. Analysis of the quaternary assemblies of the braziliantoxin-II and MT-II structures using the PISA program indicated that both models have a dimeric conformation in solution. The same analysis of the braziliantoxin-III structure indicated that this protein does not dimerize in solution and probably acts as a monomer in vivo, similar to other snake-venom Asp49-phospholipases A2.

A study of the formation of amorphous calcium phosphate and hydroxyapatite on melt quenched Bioglass(A (R)) using surface sensitive shallow angle X-ray diffraction

Melt quenched silicate glasses containing calcium, phosphorous and alkali metals have the ability to promote bone regeneration and to fuse to living bone. These glasses, including 45S5 Bioglass(A (R)) [(CaO)(26.9)(Na2O)(24.4)(SiO2)(46.1)(P2O5)(2.6)], are routinely used as clinical implants. Consequently there have been numerous studies on the structure of these glasses using conventional diffraction techniques. These studies have provided important information on the atomic structure of Bioglass(A (R)) but are of course intrinsically limited in the sense that they probe the bulk material and cannot be as sensitive to thin layers of near-surface dissolution/growth. The present study therefore uses surface sensitive shallow angle X-ray diffraction to study the formation of amorphous calcium phosphate and hydroxyapatite on Bioglass(A (R)) samples, pre-reacted in simulated body fluid (SBF). Unreacted Bioglass(A (R)) is dominated by a broad amorphous feature around 2.2 A...(-1) which is characteristic of sodium calcium silicate glass. After reacting Bioglass(A (R)) in SBF a second broad amorphous feature evolves similar to 1.6 A...(-1) which is attributed to amorphous calcium phosphate. This feature is evident for samples after only 4 h reacting in SBF and by 8 h the amorphous feature becomes comparable in magnitude to the background signal of the bulk Bioglass(A (R)). Bragg peaks characteristic of hydroxyapatite form after 1-3 days of reacting in SBF.

The automation of protein crystal presentation for x ray diffraction experiments using standing acoustic waves in a microfluidic chip environment

As the pressure continues to grow on Diamond and the world's synchrotrons for higher throughput of diffraction experiments, new and novel techniques are required for presenting micron dimension crystals to the X ray beam. Currently this task is both labour intensive and primarily a serial process. Diffraction measurements typically take milliseconds but sample preparation and presentation can reduce throughput down to 4 measurements an hour. With beamline waiting times as long as two years it is of key importance for researchers to capitalize on available beam time, generating as much data as possible. Other approaches detailed in the literature [1] [2] [3] are very much skewed towards automating, with robotics, the actions of a human protocols. The work detailed here is the development and discussion of a bottom up approach relying on SSAW self assembly, including material selection, microfluidic integration and tuning of the acoustic cavity to order the protein crystals.

The automation of protein crystal presentation for X ray diffraction experiments using standing acoustic waves in a microfluidic chip environment

As the pressure continues to grow on Diamond and the world's synchrotrons for higher throughput of diffraction experiments, new and novel techniques are required for presenting micron dimension crystals to the X ray beam. Currently this task is both labour intensive and primarily a serial process. Diffraction measurements typically take milliseconds but sample preparation and presentation can reduce throughput down to 4 measurements an hour. With beamline waiting times as long as two years it is of key importance for researchers to capitalize on available beam time, generating as much data as possible. Other approaches detailed in the literature [1] [2] [3] are very much skewed towards automating, with robotics, the actions of a human protocols. The work detailed here is the development and discussion of a bottom up approach relying on SSAW self assembly, including material selection, microfluidic integration and tuning of the acoustic cavity to order the protein crystals.

Dynamic X-ray diffraction observation of shocked solid iron up to 170 GPa

Iron is the main constituent of the core of rocky planets; therefore, understanding its phase diagram under extreme conditions is fundamental to model the planets’ evolution. Using dynamic compression by laser-driven shocks, pressure and temperature conditions close to what is found in these cores can be reached. However, it remains unclear whether phase boundaries determined at nanosecond timescales agree with static compression. Here we observed the presence of solid hexagonal close-packed iron at 170 GPa and 4,150 K, in a part of the iron phase diagram, where either a different solid structure or liquid iron has been proposed. This X-ray diffraction experiment confirms that laser compression is suitable for studying iron at conditions of deep planetary interiors difficult to achieve with static compression techniques.