77 resultados para Trinucleotide
Resumo:
Recent reports have shown neurodegenerative disorders to be associated with abnormal expansions of a CAG trinucleotide repeat allele at various autosomal loci. While normal chromosomes have 14 to 44 repeats, disease chromosomes may have 60 to 84 repeats. The number of CAG repeats on mutant chromosomes correlates with increasing severity of disease or decreasing age at onset of symptoms. Since we are interested in identifying the many quantitative trait loci (QTL) influencing brain functioning, we examined the possibility that the number of CAG repeats in the normal size range at these loci are relevant to "normal" neural functioning. We have used 150 pairs of adolescent (aged 16 years) twins and their parents to examine allele size at the MJD, SCA1, and DRPLA loci in heterozygous normal individuals. These are part of a large ongoing project using cognitive and physiological measures to investigate the genetie influences on cognition, and an extensive protocol of tests is employed to assess some of the key components of intellectual functioning. This study selected to examine full-scale psychometric IQ (FSIQ) and a measure of information processing (choice reaction time) and working memory (slow wave amplitude). CAG repeat size was determined on an ABI Genescan system following multiplex PCR amplification. Quantitative genetic analyses were performed to determine QTL effects of MJD, SCA1, and DRPLA on cognitive functioning. Analyses are in progress and will be discussed.
Resumo:
DNA must constantly be repaired to maintain genome stability. Although it is clear that DNA repair reactions depend on cell type and developmental stage, we know surprisingly little about the mechanisms that underlie this tissue specificity. This is due, in part, to the lack of adequate study systems. This review discusses recent progress toward understanding the mechanism leading to varying rates of instability at expanded trinucleotide repeats (TNRs) in different tissues. Although they are not DNA lesions, TNRs are hotspots for genome instability because normal DNA repair activities cause changes in repeat length. The rates of expansions and contractions are readily detectable and depend on cell identity, making TNR instability a particularly convenient model system. A better understanding of this type of genome instability will provide a foundation for studying tissue-specific DNA repair more generally, which has implications in cancer and other diseases caused by mutations in the caretakers of the genome.
Resumo:
Glutamate cysteine ligase (GCL) catalyzes the rate-limiting step in the de novo synthesis of glutathione (GSH). The catalytic subunit (GCLC) of GCL contains a GAG trinucleotide-repeat (TNR) polymorphism within the 5'-untranslated region (5'-UTR) that has been associated with various human disorders. Although several studies suggest that this variation influences GSH content, its implication for GCLC expression remains unknown. To better characterize its functional significance, we performed reporter gene assays with constructs containing the complete GCLC 5'-UTR upstream of a luciferase gene. Transfection of these vectors into various human cell lines did not reveal any significant differences between 7, 8, 9, or 10 GAG repeats, under either basal or oxidative stress conditions. To correlate these results with the previously described down-regulation induced by the C-129T GCLC promoter polymorphism, combinations of both variations were tested. Interestingly, the -129T allele down-regulates gene expression when combined with 7 GAG but not with 8, 9, or 10 GAG TNRs. This observation was confirmed in primary fibroblast cells, in which the combination of GAG TNR 7/7 and -129C/T genotypes decreased the GCLC protein level. These results provide evidence that interaction of the two variations can efficiently impair GCLC expression and thus suggest its involvement in the pathogenesis of diseases related to GSH metabolism.
Resumo:
Myotonic dystrophy (DM), an autosomal dominant disorder mapping to human chromosome 19q13.3, is the most common neuromuscular disease in human adults.^ Following the identification of the mutation underlying the DM phenotype, an unstable (CTG)$\sb{n}$ trinucleotide repeat in the 3$\prime$ untranslated region (UTR) of a gene encoding a ser/thr protein kinase named DM protein kinase (DMPK), the study was targeted at two questions: (1) the identification of the disease-causing mechanism(s) of the unstable repeat, and at a more basic level, (2) the identification of the origin and the mechanism(s) involved in repeat instability. The first goal was to identify the pathophysiological mechanisms of the (CTG)$\sb{n}$ repeat.^ The normal repeat is transcribed but not translated; therefore, initial studies centered on the effect on RNA transcript levels. The vast majority of DM affecteds are heterozygous for the mutant expansion, so that the normal allele interferes with the analysis of the mutant allele. A quantitative allele-specific RT-PCR procedure was developed and applied to a spectrum of patient tissue samples and cell lines. Equal levels of unprocessed pre-mRNA were determined for the wild type (+) and disease (DM) alleles in skeletal muscle and cell lines of heterozygous DM patients, indicating that any nucleosome binding has no effect at the level of transcriptional initiation and transcription of the mutant DMPK locus. In contrast, processed mRNA levels from the DM allele were reduced relative to the + allele as the size of the expansion increased. The unstable repeat, therefore, impairs post-transcriptional processing of DM allele transcripts. This phenomenon has profound effects on overall DMPK locus steady-state transcript levels in cells missing a wild type allele and does not appear to be mediated by imprinting, decreased mRNA stability, generation of aberrant splice forms, or absence of polyadenylation of the mutant allele.^ In Caucasian DM subjects, the unstable repeat is in complete linkage disequlibrium with a single haplotype composed of nine alleles within and flanking DMPK over a physical distance of 30 kb. A detailed haplotype analysis of the DM region was conducted on a Nigerian (Yoruba) DM family, the only indigenous sub-Saharan DM case reported to date. Each affected member of this family had an expanded (CTG)$\sb{n}$ repeat in one of their DMPK alleles. However, unlike all other DM populations studied thus far, disassociation of the (CTG)$\sb{n}$ repeat expansion from other alleles of the putative predisposing haplotype was found. Thus, the expanded (CTG)$\sb{n}$ repeat in this family was the result of an independent mutational event. Consequently, the origin of DM is unlikely the result of a single mutational event, and the hypothesis that a single ancestral haplotype predisposes to repeat expansion is not compelling. (Abstract shortened by UMI.) ^
Resumo:
Friedreich's ataxia is caused by the expansion of the GAA•TTC trinucleotide repeat sequence located in intron 1 of the frataxin gene. The long GAA•TTC repeats are known to form several non-B DNA structures including hairpins, triplexes, parallel DNA and sticky DNA. Therefore it is believed that alternative DNA structures play a role in the loss of mRNA transcript and functional frataxin protein in FRDA patients. We wanted to further elucidate the characteristics for formation and stability of sticky DNA by evaluating the structure in a plasmid based system in vitro and in vivo in Escherichia coli. The negative supercoil density of plasmids harboring different lengths of GAA•TTC repeats, as well as either one or two repeat tracts were studied in E. coli to determine if plasmids containing two long tracts (≥60 repeats) in a direct repeat orientation would have a different topological effect in vivo compared to plasmids that harbored only one GAA•TTC tract or two tracts of < 60 repeats. The experiments revealed that, in fact, sticky DNA forming plasmids had a lower average negative supercoil density (-σ) compared to all other control plasmids used that had the potential to form other non-B DNA structures such as triplexes or Z-DNA. Also, the requirements for in vitro dissociation and reconstitution of the DNA•DNA associated region of sticky DNA were evaluated. Results conclude that the two repeat tracts associate in the presence of negative supercoiling and MgCl 2 or MnCl2 in a time and concentration-dependent manner. Interaction of the repeat sequences was not observed in the absence of negative supercoiling and/or MgCl2 or in the presence of other monovalent or divalent cations, indicating that supercoiling and quite specific cations are needed for the association of sticky DNA. These are the first experiments studying a more specific role of supercoiling and cation influence on this DNA conformation. To support our model of the topological effects of sticky DNA in plasmids, changes in sticky DNA band migration was measured with reference to the linear DNA after treatment with increasing concentrations of ethidium bromide (EtBr). The presence of independent negative supercoil domains was confirmed by this method and found to be segregated by the DNA-DNA associated region. Sequence-specific polyamide molecules were used to test the effect of binding of the ligands to the GAA•TTC repeats on the inhibition of sticky DNA. The destabilization of the sticky DNA conformation in vitro through this binding of the polyamides demonstrated the first conceptual therapeutic approach for the treatment of FRDA at the DNA molecular level. ^ Thus, examining the properties of sticky DNA formed by these long repeat tracts is important in the elucidation of the possible role of sticky DNA in Friedreich's ataxia. ^
Resumo:
A quantitative and selective genetic assay was developed to monitor expansions of trinucleotide repeats (TNRs) in yeast. A promoter containing 25 repeats allows expression of a URA3 reporter gene and yields sensitivity to the drug 5-fluoroorotic acid. Expansion of the TNR to 30 or more repeats turns off URA3 and provides drug resistance. When integrated at either of two chromosomal loci, expansion rates were 1 × 10−5 to 4 × 10−5 per generation if CTG repeats were replicated on the lagging daughter strand. PCR analysis indicated that 5–28 additional repeats were present in 95% of the expanded alleles. No significant changes in CTG expansion rates occurred in strains deficient in the mismatch repair gene MSH2 or the recombination gene RAD52. The frequent nature of CTG expansions suggests that the threshold number for this repeat is below 25 in this system. In contrast, expansions of the complementary repeat CAG occurred at 500- to 1,000-fold lower rates, similar to a randomized (C,A,G) control sequence. When the reporter plasmid was inverted within the chromosome, switching the leading and lagging strands of replication, frequent expansions were observed only when CTG repeats resided on the lagging daughter strand. Among the rare CAG expansions, the largest gain in tract size was 38 repeats. The control repeats CTA and TAG showed no detectable rate of expansions. The orientation-dependence and sequence-specificity data support the model that expansions of CTG and CAG tracts result from aberrant DNA replication via hairpin-containing Okazaki fragments.
Resumo:
Expansion of a CTG trinucleotide repeat in the 3′ untranslated region (UTR) of DMPK, the gene encoding myotonic dystrophy protein kinase, induces the dominantly inherited neuromuscular disorder myotonic dystrophy (DM). Transcripts containing the expanded trinucleotide are abundant in differentiated cultured myoblasts, and they are spliced and polyadenylylated normally. However, mutant transcripts never reach the cytoplasm in these nonmitotic cells; instead, they form stable clusters that are tightly linked to the nuclear matrix, which can prevent effective biochemical purification of these transcripts. In DM patients, reduced DMPK protein levels, consequent to nuclear retention of mutant transcripts, are probably a cause of disease development. Formation of nuclear foci is a novel mechanism for preventing transcript export and effecting a loss of gene function.
Evolution of the Friedreich’s ataxia trinucleotide repeat expansion: Founder effect and premutations
Resumo:
Friedreich’s ataxia, the most frequent inherited ataxia, is caused, in the vast majority of cases, by large GAA repeat expansions in the first intron of the frataxin gene. The normal sequence corresponds to a moderately polymorphic trinucleotide repeat with bimodal size distribution. Small normal alleles have approximately eight to nine repeats whereas a more heterogeneous mode of large normal alleles ranges from 16 to 34 GAA. The latter class accounts for ≈17% of normal alleles. To identify the origin of the expansion mutation, we analyzed linkage disequilibrium between expansion mutations or normal alleles and a haplotype of five polymorphic markers within or close to the frataxin gene; 51% of the expansions were associated with a single haplotype, and the other expansions were associated with haplotypes that could be related to the major one by mutation at a polymorphic marker or by ancient recombination. Of interest, the major haplotype associated with expansion is also the major haplotype associated with the larger alleles in the normal size range and was almost never found associated with the smaller normal alleles. The results indicate that most if not all large normal alleles derive from a single founder chromosome and that they represent a reservoir for larger expansion events, possibly through “premutation” intermediates. Indeed, we found two such alleles (42 and 60 GAA) that underwent cataclysmic expansion to pathological range in a single generation. This stepwise evolution to large trinucleotide expansions already was suggested for myotonic dystrophy and fragile X syndrome and may relate to a common mutational mechanism, despite sequence motif differences.
Resumo:
Several human neurological disorders are associated with proteins containing abnormally long runs of glutamine residues. Strikingly, most of these proteins contain two or more additional long runs of amino acids other than glutamine. We screened the current human, mouse, Drosophila, yeast, and Escherichia coli protein sequence data bases and identified all proteins containing multiple long homopeptides. This search found multiple long homopeptides in about 12% of Drosophila proteins but in only about 1.7% of human, mouse, and yeast proteins and none among E. coli proteins. Most of these sequences show other unusual sequence features, including multiple charge clusters and excessive counts of homopeptides of length > or = two amino acid residues. Intriguingly, a large majority of the identified Drosophila proteins are essential developmental proteins and, in particular, most play a role in central nervous system development. Almost half of the human and mouse proteins identified are homeotic homologs. The role of long homopeptides in fine-tuning protein conformation for multiple functional activities is discussed. The relative contributions of strand slippage and of dynamic mutation are also addressed. Several new experiments are proposed.
Resumo:
Trinucleotide repeat (TNR) expansion is the cause of more than 40 types of human neurodegenerative diseases such as Huntington’s disease. Recent studies have linked TNR expansion with oxidative DNA damage and base excision repair (BER). In this research, we provided the first evidence that oxidative DNA damage can induce CAG repeat deletion/contraction via BER. We found that BER of an oxidized DNA base lesion, 8-oxoguanine in a CAG repeat tract, resulted in the formation of a CTG hairpin at the template strand. DNA polymerase β (pol b) then skipped over the hairpin creating a 5’-flap that was cleaved by flap endonuclease 1 (FEN1) leading to CAG repeat deletion. To further investigate whether BER may help to shorten an expanded TNR tract, we examined BER in a CAG repeat hairpin loop. We found that 8-oxoguanine DNA glycosylase removed the oxidized base located in the loop region of the hairpin leaving an abasic site. Apurinic/apyrimidinic (AP) endonuclease 1 then incised the 5’-end of the abasic site leaving a nick in the loop. This further converted the hairpin into an intermediate with a 3’-flap and a 5’-flap. As a 5’-3’ endonuclease, FEN1 cleaved the 5’-flap, whereas a 3’-5’ endonuclease, Mus81/Eme1, removed the 3’-flap. The coordination between FEN1 and Mus81/Eme1 ultimately resulted in removal of a CAG repeat hairpin attenuating or preventing TNR expansion. To further explore if pol β bypass of an oxidized base lesion, 5’,8-cyclodeoxyadenosine, may affect TNR instability, we examined pol β DNA synthesis in bypassing this base lesion and found that the lesion preferentially induced TNR deletion during BER and Okazaki fragment maturation. The repeat deletion was mediated by the formation of a loop in the template strand induced specifically by the damage. Pol β then skipped over the loop structure creating a 5’-flap that was efficiently removed by FEN1 leading to repeat deletion. Our study demonstrates that pol β-mediated BER plays an important role in mediating TNR deletion and removing a TNR hairpin to prevent TNR expansion. Our research provides a molecular basis for further developing BER as a target for prevention and treatment of neurodegenerative diseases caused by TNR expansion.
Resumo:
Spinocerebellar ataxia type 1 (SCA1), spinocerebellar ataxia type 2 (SCA2) and Machado-Joseph disease or spinocerebellar ataxia type 3 (MJD/SCA3) are three distinctive forms of autosomal dominant spinocerebellar ataxia (SCA) caused by expansions of an unstable CAG repeat localized in the coding region of the causative genes. Another related disease, dentatorubropallidoluysian atrophy (DRPLA) is also caused by an unstable triplet repeat and can present as SCA in late onset patients. We investigated the frequency of the SCA1, SCA2, MJD/SCA3 and DRPLA mutations in 328 Brazilian patients with SCA, belonging to 90 unrelated families with various patterns of inheritance and originating in different geographic regions of Brazil. We found mutations in 35 families (39%), 32 of them with a clear autosomal dominant inheritance. The frequency of the SCA1 mutation was 3% of all patients; and 6 % in the dominantly inherited SCAs. We identified the SCA2 mutation in 6% of all families and in 9% of the families with autosomal dominant inheritance. The MJD/SCA3 mutation was detected in 30 % of all patients; and in the 44% of the dominantly inherited cases. We found no DRPLA mutation. In addition, we observed variability in the frequency of the different mutations according to geographic origin of the patients, which is probably related to the distinct colonization of different parts of Brazil. These results suggest that SCA may be occasionally caused by the SCA1 and SCA2 mutations in the Brazilian population, and that the MJD/SCA3 mutation is the most common cause of dominantly inherited SCA in Brazil.
Resumo:
A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.
Resumo:
Two families, originally diagnosed as having nonsyndromic X-linked mental retardation (NSXLMR), were reviewed when it was shown that they had a 24-bp duplication (428-45 1dup(24bp)) in the ARX gene [Stromme et al., 2002: Nat Genet 30:441-445]. This same duplication had also been found in three other families: one with X-linked infantile spasms and hypsarrhythmia (X-linked West syndrome, MIM 308350) and two with XLMR and dystonic movements of the hands (Partington syndrome, MIM 309510). On review, manifestations of both West and Partington syndromes were found in some individuals from both families. In addition, it was found that one individual had autism and two had autistic behavior, one of whom had epilepsy. The degree of mental retardation ranged from mild to severe. A GCG trinucleotide expansion (GCG)10+7 and a deletion of 1,517 by in the ARX gene have also been found in association with the West syndrome, and a missense mutation (1058C >T) in a family with a newly recognized form of myoclonic epilepsy, severe mental retardation, and spastic paraplegia [Scheffer et al., 2002: Neurology, in press]. Evidently all these disorders are expressions of mutations in the same gene. It remains to be seen what proportions of patients with infantile spasms, focal dystonia, autism, epilepsy, and nonsyndromic mental retardation are accounted for by mutations in the ARX gene. (C) 2002 Wiley-Liss, Inc.
Resumo:
Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).