Talent detection in taekwondo: which factors are associated with the longitudinal competitive success?

Background Several morphological and functional characteristics are associated with the performance of taekwondo (TKD) adult athletes. However, we did not find any longitudinal study associating these features to the future performance of young athletes, and thereby, identifying the best variables to use in a battery of tests to talent detection. Therefore, the aim of this study is answer the question which factors are associated with the longitudinal competitive success of TKD young athletes over five competitive years (2008 to 2012).Material &Methods: Six taekwondo athletes (13.06 +/- 1.07 years, 43.6 +/- 6.6 kg, 157.9 +/- 8.3 cm), who trained three to six hours per week, for more than three years, were assessed on 32 maturational indicators, of body composition, anthropometric and functional, using anthropometric techniques, dual energy x-ray absorptiometry, carpal radiography and contact platform. To determine the competitive ranking, the competitive results of athletes from 2008 to 2012 were analysed, and these values were correlated with the other 32 indicators for determining the Longitudinal Predictors of Performance in TKD (LPPT). Moreover, one of the athletes achieved results notably higher than the other, being medalled at Junior World Championships. Therefore, all variables were transformed into z-scores and all those in which this athlete presented superior performance in 1 z-scores were considered as LPPT. Results: The athlete of reference (the first in Longitudinal Competitive Ranking 2008-2012) distinguished, in accordance with the criteria, in nineteen LPPT indicators. The ranking was correlated with 6 LPPT parameters, including one from the maturation group of indicators and five from the functional group.Conclusion: Our results allowed us to identify several factors that are related to longitudinal competitive success in taekwondo young athletes. These factors should be considered by coaches to the proper selection of training programs, as well as for the pre-selection of young talents in competitive taekwondo. However, these results apply only to the Portuguese taekwondo adolescent athletes, being of limited generalizability.

Nutritional intake and body composition of adolescent soccer player of two different levels of performance: a comparative study

Soccer participation worldwide is increasing and every club try to discover new talents. It is well know that there is an important correlation between body composition (BC) and talent detection (TD) and when coaches and selectors choose players, they tend to choose them with optimum BC.

ISSP Position Stand: To Test or Not to Test? The Use of Physical Skill Tests in Early Phases of Sport Development

A Searching for talent and the assessing ability in young prospects from individual and team sports often include measurement, analysis, and evaluation of physical and motor skills. The use of these tests in early stages of talent development has been widely observed in both female and male prospects. The purpose of this paper is to review a series of studies conducted on talented and less-talented athletes/ players that were aimed at distinguishing between the two groups and at predicting the athletes’/players’ future achievements/success. Thirteen studies examining the use of physical and motor skill tests in young prospects are reviewed. Based on this review, four main observations are highlighted and a number of benefits and limitations associated with the use of such tests are discussed. It is recommended that (1) coaches reduce the number of batteries of physical and motor skill tests used in early phases of talent development and (2) coaches and sport scientists specializing in measurement and evaluation cooperate in order to improve the effectiveness of the application and interpretation of physical skill tests given to prospects at early stages of talent development.

Sobre o Desenvolvimento do Talento no Desporto: Um Contributo dos Modelos Teóricos do Desenvolvimento Desportivo

ABSTRACT: With this article, we aim to offer a conceptual synthesis of some of the most important developments in past decades on the subject of talent in sport, while also helping sports stakeholders, particularly managers and coaches, to recognize and apply these conclusions in their practices. The article starts with a brief historical review, which explores how there has been a shift from a talent detection perspective to a talent development perspective and to a holistic vision of athletes and their background context. Secondly, the article presents an overview of the main theoretical models put forward in literature on sport psychology, including career-transition-based models and talent-and-expertise-based models. Finally, as the conceptual model most widely referred to in literature, a detailed analysis of the Development Model of Sports Participation (Côté, Baker & Abernethy, 2007), is made, especially with regard to development processes relating to standards of practice (e.g. diversification and specialization) and psychosocial influences, aspects that form the basis of all-round athlete development.

Sobre o Desenvolvimento do Talento no Desporto: Um Contributo dos Modelos Teóricos do Desenvolvimento Desportivo

ABSTRACT: With this article, we aim to offer a conceptual synthesis of some of the most important developments in past decades on the subject of talent in sport, while also helping sports stakeholders, particularly managers and coaches, to recognize and apply these conclusions in their practices. The article starts with a brief historical review, which explores how there has been a shift from a talent detection perspective to a talent development perspective and to a holistic vision of athletes and their background context. Secondly, the article presents an overview of the main theoretical models put forward in literature on sport psychology, including career-transition-based models and talent-and-expertise-based models. Finally, as the conceptual model most widely referred to in literature, a detailed analysis of the Development Model of Sports Participation (Côté, Baker & Abernethy, 2007), is made, especially with regard to development processes relating to standards of practice (e.g. diversification and specialization) and psychosocial influences, aspects that form the basis of all-round athlete development.

Talent in autism: hyper-systemising, hyper-attention to detail and sensory hypersensitivity

We argue that hyper-systemizing predisposes individuals to show talent, and review evidence that hyper-systemizing is part of the cognitive style of people with autism spectrum conditions (ASC). We then clarify the hyper-systemizing theory, contrasting it to the weak central coherence (WCC) and executive dysfunction (ED) theories. The ED theory has difficulty explaining the existence of talent in ASC. While both hyper-systemizing and WCC theories postulate excellent attention to detail, by itself excellent attention to detail will not produce talent. By contrast, the hyper-systemizing theory argues that the excellent attention to detail is directed towards detecting 'if p, then q' rules (or [input-operation-output] reasoning). Such law-based pattern recognition systems can produce talent in systemizable domains. Finally, we argue that the excellent attention to detail in ASC is itself a consequence of sensory hypersensitivity. We review an experiment from our laboratory demonstrating sensory hypersensitivity detection thresholds in vision. We conclude that the origins of the association between autism and talent begin at the sensory level, include excellent attention to detail and end with hyper-systemizing.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Salto triplo : o sistema de preparaçao do desportista : da detecção a promoção do talento

Universidade Estadual de Campinas . Faculdade de Educação Física

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.