National estimates of children missing involuntarily or for benign reasons /

Shipping list no.: 2005-0220-P.

Children abducted by family members : national estimates and characteristics /

Shipping list no. 2003-0019-P.

Community-based AIDS prevention : studies of intravenous drug users and their sex partners : proceedings of the First Annual NADR National Meeting.

Mode of access: Internet.

Experimental studies of di-jet survival and surface emission bias in Au plus Au collisions via angular correlations with respect to back-to-back leading hadrons

We report first results from an analysis based on a new multi-hadron correlation technique, exploring jet-medium interactions and di-jet surface emission bias at the BNL Relativistic Heavy Ion Collider (RHIC). Pairs of back-to-back high-transverse-momentum hadrons are used for triggers to study associated hadron distributions. In contrast with two-and three-particle correlations with a single trigger with similar kinematic selections, the associated hadron distribution of both trigger sides reveals no modification in either relative pseudorapidity Delta eta or relative azimuthal angle Delta phi from d + Au to central Au + Au collisions. We determine associated hadron yields and spectra as well as production rates for such correlated back-to-back triggers to gain additional insights on medium properties.

X-ray scattering studies of mixed langmuir monolayers and Langmuir-Blodgett films of a noncentrosymmetric porphyrin with cadmium arachidate

The structures of mixed Langmuir (floating) monolayers and Langmuir-Blodgett (LB) films of a phenanthroline-porphyrin with cadmium arachidate (PhenPor + CdAr) have been investigated by synchrotron X-ray grazing incidence diffraction (GIXD) and specular X-ray reflectivity (SXR). GIXD measurements of the floating monolayers showed only one peak, arising from the CdAr domains in the films, at a scattering angle of 21.5 degrees. This is consistent with a hexagonal structure (alpha = 4.77 Angstrom). The correlation length in these domains is 250 Angstrom. GMD measurements of the LB films, however, show two sets of diffraction features: one arises from CdAr domains with a rectangular in-plane structure (alpha = 7.44 Angstrom and b = 4.90 Angstrom) and a correlation length of 85 Angstrom; the other is from porphyrin domains with an oblique in-plane structure (alpha (p) 15.2 Angstrom, b(p) = 8.86 Angstrom, and gamma (p) = 80 degrees) and a correlation length of 105 Angstrom. These dimensions are consistent with the surface pressure-area isotherm measurements and indicate that the two components are immiscible. The thickness of the bilayer is 57 Angstrom, and there is no correlation between the bilayers. Introduction of a trigger compound does not alter the structure of the films but slightly increases the bilayer thickness. The SXR measurements of the floating monolayers also support the suggested immiscibility of the two components in the films.

The survival advantage of milk and dairy consumption: An overview of evidence from cohort studies of vascular diseases, diabetes and cancer

Objectives: To conduct it detailed evaluation, with meta-analyses, of the published evidence on milk and dairy consumption and the incidence of vascular diseases and diabetes. Also to summarise the evidence on milk and dairy consumption and cancer reported by the World Cancer Research Fund and then to consider the relevance of milk and dairy consumption to survival in the UK, a typical Western community. Finally, published evidence on relationships with whole milk and fat-reduced milks was examined. Methods: Prospective cohort studies of vascular disease and diabetes with baseline data on milk or dairy consumption and a relevant disease outcome were identified by searching MEDLINE, and reference lists in the relevant published reports. Meta-analyses of relationships in these reports were conducted. The likely effect of milk and dairy consumption on survival was then considered, taking into account the results of published overviews of relationships of these foods with cancer. Results: From meta-analysis of 15 studies the relative risk of stroke and/or heart disease in subjects with high milk or dairy consumption was 0.84 (95% CI 0.76, 0,93) and 0.79 (0.75, 0.82) respectively, relative to the risk in those with low consumption. Four studies reported incident diabetes as an outcome, and the relative risk in the Subjects with the highest intake of milk or diary foods was 0.92 (0.86, 0.97). Conclusions: Set against the proportion of total deaths attributable to the life-threatening diseases in the UK, vascular disease, diabetes and cancer, the results of meta-analyses provide evidence of an overall survival advantage from the consumption of milk and dairy foods.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Theoretical studies of microfluidics: "walking" drops and "melting" snowflakes.

The present PhD thesis summarizes two examples of research in microfluidics. Both times water was the subject of interest, once in the liquid state (droplets adsorbed on chemically functionalized surfaces), the other time in the solid state (ice snowflakes and their fractal behaviour). The first problem deals with a slipping nano-droplet of water adsorbed on a surface with photo-switchable wettability characteristics. Main focus was on identifying the underlying driving forces and mechanical principles at the molecular level of detail. Molecular Dynamics simulation was employed as investigative tool owing to its record of successfully describing the microscopic behaviour of liquids at interfaces. To reproduce the specialized surface on which a water droplet can effectively “walk”, a new implicit surface potential was developed. Applying this new method the experimentally observed droplet slippage could be reproduced successfully. Next the movement of the droplet was analyzed at various conditions emphasizing on the behaviour of the water molecules in contact with the surface. The main objective was to identify driving forces and molecular mechanisms underlying the slippage process. The second part of this thesis is concerned with theoretical studies of snowflake melting. In the present work snowflakes are represented by filled von Koch-like fractals of mesoscopic beads. A new algorithm has been developed from scratch to simulate the thermal collapse of fractal structures based on Monte Carlo and Random Walk Simulations (MCRWS). The developed method was applied and compared to Molecular Dynamics simulations regarding the melting of ice snowflake crystals and new parameters were derived from this comparison. Bigger snow-fractals were then studied looking at the time evolution at different temperatures again making use of the developed MCRWS method. This was accompanied by an in-depth analysis of fractal properties (border length and gyration radius) in order to shed light on the dynamics of the melting process.

In vivo longitudinal studies of spinal cord injury and vascular endothelial growth factor treatment

Approximately 12,000 new cases of spinal cord injury (SCI) are added each year to the estimated 259,000 Americans living with SCI. The majority of these patients return to society, their lives forever changed by permanent loss of sensory and motor function. While there are no FDA approved drugs for the treatment of SCI or a universally accepted standard therapy, the current though controversial treatment includes the delivery of high dosages of the corticosteroid methyliprednisolone sodium succinate, surgical interventions to stabilize the spinal column, and physical rehabilitation. It is therefore critically important to fully understand the pathology of injury and determine novel courses and rationally-based therapies for SCI. ^ Vascular endothelial growth factor (VEGF) is an attractive target for treating central nervous system (CNS) injury and disease because it has been shown to influence angiogenesis and neuroprotection. Preliminary studies have indicated that increased vasculature may be associated with functional recovery; therefore exogenous delivery of a pro-angiogenic growth factor such as VEGF may improve neurobehavioral outcome. In addition, VEGF may provide protection from secondary injury and result in increased survival and axonal sprouting. ^ In these studies, SCI rats received acute intraspinal injections of VEGF, the antibody to VEGF, or vehicle control. The effect of these various agents was investigated using longitudinalmulti-modal magnetic resonance imaging (MRI), neuro- and sensory behavioral assays, and end point immunohistochemistry. We found that rats that received VEGF after SCI had increased tissue sparing and improved white matter integrity at the earlier time points as shown by advanced magnetic resonance imaging (MRI) techniques. However, these favorable effects of VEGF were not maintained, suggesting that additional treatments with VEGF at multiple time points may be more beneficial, Histological examinations revealed that VEGF treatment may result in increased oligodendrogenesis and therefore may eventually lead to remyelination and improved functional outcome. ^ On the neurobehavioral studies, treatments with VEGF and Anti-VEGF did not significantly affect performance on tests of open-field locomotion, grid walk, inclined plane, or rearing. However, VEGF treatment resulted in significantly increased incidence of chronic neuropathic pain. This phenomenon could possibly be attributed to the fact that VEGF treatment may promote axonal sprouting and also results in tissue sparing, thereby providing a substrate for the growth of new axons. New connections made by these sprouting axons may involve components of pathways involved in the transmission of pain and therefore result in increased pain in those animals. ^

Venous thromboembolism in patients with acute leukemia: Prevalence, incidence, recurrence of thrombosis, risk factors, and impact on survival

Venous thromboembolism (VTE), including deep vein thrombosis (DVT) and pulmonary embolism (PE), is the third most preventable cardiovascular disease and a growing public health problem in the United States. The incidence of VTE remains high with an annual estimate of more than 600,000 symptomatic events. DVT affects an estimated 2 million American each year with a death toll of 300,000 persons per year from DVT-related PE. Leukemia patients are at high risk for both hemorrhage and thrombosis; however, little is known about thrombosis among acute leukemia patients. The ultimate goal of this dissertation was to obtain deep understanding of thrombotic issue among acute leukemia patients. The dissertation was presented in a format of three papers. First paper mainly looked at distribution and risk factors associated with development of VTE among patients with acute leukemia prior to leukemia treatment. Second paper looked at incidence, risk factors, and impact of VTE on survival of patients with acute lymphoblastic leukemia during treatment. Third paper looked at recurrence and risk factors for VTE recurrence among acute leukemia patients with an initial episode of VTE. Descriptive statistics, Chi-squared or Fisher's exact test, median test, Mann-Whitney test, logistic regression analysis, Nonparametric Estimation Kaplan-Meier with a log-rank test or Cox model were used when appropriate. Results from analyses indicated that acute leukemia patients had a high prevalence, incidence, and recurrent rate of VTE. Prior history of VTE, obesity, older age, low platelet account, presence of Philadelphia positive ALL, use of oral contraceptives or hormone replacement therapy, presence of malignancies, and co-morbidities may place leukemia patients at an increased risk for VTE development or recurrence. Interestingly, development of VTE was not associated with a higher risk of death among hospitalized acute leukemia patients.^

Audience studies of the performing arts and museums : a critical review /

Mode of access: Internet.

Strategies against racism: a comparison of a social movement and case studies of anti-racist policy and practice in the local state

The thesis compares two contrasting strategies employed with the aim of combating particular forms of racism within contemporary Britain. Both are assessed as political strategies in their own right and placed within the broader context of reformist and revolutionary political traditions. The sociology of social movements is examined critically, as are Marxist and post-Marxist writings on the role of human agency within social structures and on the nature of social movements. The history of the Anti Nazi League (ANL) in the late 1970s and its opposition to the National Front is considered as an example of anti-racist social movement based on the Trotskyist model of the United Front. The degree to which the Anti Nazi League corresponded to such a model is analysed as are the potential broader applications for such a strategy. The strategy with which the ANL is compared is the development of anti-racist and equal opportunities policies within local government in the 1980s, primarily by Labour-controlled local authorities. The theory of the local state and the political phenomenon of municipal socialism are discussed, specifically the role of various groups operating in and around local authorities in the formation and implementation of anti-racist policy and practice. Following this general discussion, two case studies in each of the areas of local authority housing, education and employment are explored to consider in depth the problems of specific anti-racist policies. In summation the efficacy of the two strategies are considered as parts of wider political currents in tandem with their declared specific objectives.

Functional studies of lignin biosynthesis genes and putative flowering gene in Miscanthus x giganteus and studies on indolyl glucosinolate biosynthesis and translocation in Brassica oleracea

The first topic area of this thesis involved studies on the accumulation and translocation of glucosinolates (GSs), bioactive secondary plant compounds, in broccoli plants. Changes in GS accumulation and gene expression levels in response to exogeneous methyl jasmonate (MeJA) treatment were analyzed in different tissue types at different developmental stages of broccoli. Greater accumulation of GSs with MeJA treatment was observed in apical leaves of broccoli seedlings and florets of plants at harvest maturity. Increases in indolyl GS in apical leaves of seedlings and florets were coupled with the up-regulation of indolyl GS biosynthesis genes. The accumulation of indolyl GSs appears to be modulated by MeJA treatment in an organ-specific manner for optimal distribution of defense substances in the plant. Metabolic profiling of hydrophilic metabolites using GC-MS demonstrated increased accumulation of various phenolics, ascorbates and amino acids in broccoli tissues after MeJA treatment. Distinct changes in carbohydrate levels observed between different tissues (vegetative leaves and floret tissues) of broccoli plants after treatment suggest that carbon metabolism is differentially modulated by MeJA treatment in different tissue types depending on sink-source relationships. Reduced levels of hexose sugars and tricarboxylic acid intermediates after MeJA treatment may reflect the increased requirement for carbon and energy needed to drive secondary product biosynthesis to accumulate metabolites for defense against insects and other herbivores. Substantial increases of indolyl and aromatic GSs after exogenous treatment with MeJA in stem and petioles of seedlings and the existence of intact indolyl-GS forms in phloem exudates suggest enhanced de novo synthesis in combination with active transport. Indoly GSs share structural similarities with the auxin, IAA, and may interact with components of the auxin transport system for intra- and extra-cellular transport or translocation. Application of the auxin efflux inhibitor, 1-naphthylphthalamic acid (NPA) reduced MeJA-mediated accumulation of indolyl GSs in broccoli florets and seedling tissues. NPA did not inhibit expression of indolyl GS biosynthesis genes shown to be upregulated by MeJA treatment or the accumulation of tryptophan, the amino acid precursor of indolyl GSs. Exogenous application of benzyl GS to Arabidopsis roots induced ectopic expression of the PIN1 protein associated with the auxin transport system similar to treatment with NPA, again suggesting GS interaction with the auxin efflux carrier system. The inhibitory effect of NPA on MeJA-mediated accumulation of GS may be due to competitive binding of NPA to auxin efflux carrier components and that GS transport is mediated by the auxin transport system. The inhibitory effect of NPA on indolyl and aromatic GS accumulation and the bioactivity of exogenous treatment of these GS compounds in PIN1 localization, Arabidopsis root growth, and gravitrophic response suggest that indolyl and aromatic GSs may be antagonistic to IAA transport and biosynthesis. Indolyl and aromatic GSs can also be potentially converted into IAA by hydrolysis. This intrinsic feature of GSs may be the part of a sophisticated regulatory process where the metabolic pathways in the plant shift from active growth to a reversible defense posture in response to biotic or abiotic stress. It seems likely that indolyl and aromatic GSs are important compounds that provide connections between jasmonate and auxin signaling. Further studies are required to reveal the regulatory mechanism for crosstalk between the two hormones. The third part of this research was to investigate effect of selenium fertilization and MeJA treatment on accumulation of GSs in broccoli florets. Increasing dietary intake of the element selenium (Se) has been shown to reduce the risk of cancer. Simultaneous enhancement of both Se and GS concentrations in broccoli floret tissue were conducted through the combined treatment of MeJA with Se fertilization. A low level of Se fertilization (concentration) with MeJA treatment displayed no significant changes in total aliphatic GS concentrations with 90% and 50% increases in indolyl and total GSs concentrations, respectively. This result suggests that Se- and GS-enriched broccoli with improved health-promoting properties can be generated by this combined treatment. The second topic of this thesis was conducted to provide basic information required to improve biomass quality and productivity and develop tools for gene transformation in Miscanthus x giganteus. The perennial rhizomatous grass, Miscanthus x giganteus is an ideal biomass crop due to its rapid vegetative growth and high biomass yield potential. As a naturally occurring sterile hybrid, M. x giganteus must be propagated vegetatively by mechanicalling divided rhizomes or from micropropagated plantlets. The effect of callus type, age and culture methods on regeneration competence was studied to improve regeneration efficiency and shorten the period of tissue culture in M. x giganteus propagation. Seven lignin biosynthesis genes and one putative flowering gene were isolated from M. x giganteus by PCR reactions using maize othologous sequences. Southern hybridization and nuclear DNA content analysis indicated that the genes isolated from M. x giganteus exist in the genome of other Miscanthus species as multiple copies. Analysis of lignin content and histological staining of lignin deposition indicated that higher lignin content is found in mature stem node tissues compared to young leaves and apical stem nodal tissues. Cell wall lignification is associated with increasing tissue maturity in Miscanthus species. RNAi and antisense constructs harboring sequences of these genes were developed to generate Miscanthus transgenic plants with suppressed of lignin biosynthesis and delayed flowering.

Studies of antihypertensive drug persistence and adherence in the Glasgow Blood Pressure Clinic

Hypertension (HTN) is a major risk factor for cardiovascular diseases including stroke, coronary heart disease (CHD), chronic renal failure, peripheral vascular disease, myocardial infarction, congestive heart failure and premature death. The prevalence of HTN in Scotland is very high and although a high proportion of the patients receive antihypertensive medications, blood pressure (BP) control is very low. Recommendations for starting a specific antihypertensive class have been debated between various guidelines over the years. Some guidelines and HTN studies have preferred to start with a combination of an antihypertensive class instead of using a single therapy, and they have found greater BP reductions with combination therapies than with monotherapy. However, it has been shown in several clinical trials that 20% to 35% of hypertensive patients could not achieve the target BP, even though they received more than three antihypertensive medications. Several factors were found to affect BP control. Adherence and persistence were considered as the factors contributing the most to uncontrolled hypertension. Other factors such as age, sex, body mass index (BMI), alcohol intake, baseline systolic BP (SBP), and the communication between physicians and patients have been shown to be associated with uncontrolled BP and resistant hypertension. Persistence, adherence and compliance are interchangeable terms and have been used in the literature to describe a patient’s behaviour with their antihypertensive drugs and prescriptions. The methods used to determine persistence and adherence, as well as the inclusion and exclusion criteria, vary between persistence and adherence studies. The prevalence of persistence and adherence have varied between these studies, and were determined to be high in some studies and low in others. The initiation of a specific antihypertensive class has frequently been associated with an increase or decrease in adherence and persistence. The tolerability and efficacy of the initial antihypertensive class have been the most common methods of explaining this association. There are also many factors that suggest a relationship with adherence and persistence. Some factors in previous studies, such as age, were frequently associated with adherence and persistence. On the other hand, relationships with certain factors have varied between the studies. The associations of age, sex, alcohol use, smoking, baseline systolic blood pressure (SBP) and diastolic BP (DBP), the presence of comorbidities, an increase in the number of pills and the relationship between patients and physicians with adherence and persistence have been the most commonly investigated factors. Most studies have defined persistence in terms of a patient still taking medication after a period of time. A medication possession ratio (MPR) ≥ 80 has been used to define compliance. Either of these terminologies, or both, have been used to estimate adherence. In this study, I used the same definition for persistence to identify patients who have continued with their initial treatment, and used persistence and MPR to define patients who adhered to their initial treatment. The aim of this study was to estimate the prevalence of persistence and adherence in Scotland. Also, factors that could have had an effect on persistence and adherence were studied. The number of antihypertensive drugs taken by patients during the study and factors that led to an increase in patients being on a combination therapy were also evaluated. The prevalence of resistance and BP control were determined by taking the BP after the last drug had been taken by persistent patients during five follow-up studies. The relationship of factors such as age, sex, BMI, alcohol use, smoking, estimated glomerular filtration rate (eGFR), and albumin levels with BP reductions for each antihypertensive class were determined. Information Services Division (ISD) data, which includes all antihypertensive drugs, were collected from pharmacies in Scotland and linked to the Glasgow Blood Pressure Clinic (GBPC) database. This database also includes demographic characteristics, BP readings and clinical results for all patients attending the GBPC. The case notes for patients who attended the GBPC were reviewed and all new antihypertensive drugs that were prescribed between visits, BP before and after taking drugs, and any changes in the hypertensive drugs were recorded. A total of 4,232 hypertensive patients were included in the first study. The first study showed that angiotensin converting enzyme inhibitor (ACEI) and beta-blockers (BB) were the most prescribed antihypertensive classes between 2004 and 2013. Calcium channel blockers (CCB), thiazide diuretics and angiotensin receptor blockers (ARB) followed ACEI and BB as the most prescribed drugs during the same period. The prescription trend of the antihypertensive class has changed over the years with an increase in prescriptions for ACEI and ARB and a decrease in prescriptions for BB and diuretics. I observed a difference in antihypertensive class prescriptions by age, sex, SBP and BMI. For example, CCB, thiazide diuretics and alpha-blockers were more likely to be prescribed to older patients, while ACEI, ARB or BB were more commonly prescribed for younger patients. In a second study, 4,232 and 3,149 hypertensive patients were included to investigate the prevalence of persistence in the Scottish population in 1- and 5-year studies, respectively. The prevalence of persistence in the 1-year study was 72.9%, while it was only 62.8% in the 5-year study. Those patients taking ARB and ACEI showed high rates of persistence and those taking diuretics and alpha blockers had low rates of persistence. The association of persistence with clinical characteristics was also investigated. Younger patients were more likely to totally stop their treatment before restarting their treatment with other antihypertensive drugs. Furthermore, patients who had high SBP tended to be non-persistent. In a third study, 3,085 and 1,979 patients who persisted with their treatment were included. In the first part of the study, MPR was calculated, and patients with an MPR ≥ 80 were considered as adherent. Adherence rates were 29.9% and 23.4% in the 1- and 5-year studies, respectively. Patients who initiated the study with ACEI were more likely to adhere to their treatments. However, patients who initiated the study with thiazide diuretics were less likely to adhere to their treatments. Sex, age and BMI were different between the adherence and non-adherence groups. Age was an independent factor affecting adherence rates during both the 1- and 5-year studies with older patients being more likely to be adherent. In the second part of the study, pharmacy databases were checked with patients' case notes to compare antihypertensive drugs that were collected from the pharmacy with the antihypertensive prescription given during the patient’s clinical visit. While 78.6% of the antihypertensive drugs were collected between clinical visits, 21.4% were not collected. Patients who had more days to see the doctor in the subsequent visit were more likely to not collect their prescriptions. In a fourth study, 3,085 and 1,979 persistent patients were included to calculate the number of antihypertensive classes that were added to the initial drug during the 1-year and 5-year studies, respectively. Patients who continued with treatment as a monotherapy and who needed a combination therapy were investigated during the 1- and 5-year studies. In all, 55.8% used antihypertensive drugs as a monotherapy and 44.2% used them as a combination therapy during the 1-year study. While 28.2% of patients continued with treatment without the required additional therapy, 71.8% of the patients needed additional therapy. In all, 20.8% and 46.5% of patients required three different antihypertensive classes or more during the 1-year and 5-year studies, respectively. Patients who started with ACEI, ARB and BB were more likely to continue as monotherapy and less likely to need two more antihypertensive drugs compared with those who started with alpha-blockers, non-thiazide diuretics and CCB. Older ages, high BMI levels, high SBP and high alcohol intake were independent factors that led to an increase in the probability of patients taking combination therapies. In the first part of the final study, BPs were recorded after the last drug had been taken during the 5 year study. There were 815 persistent patients who were assigned for this purpose. Of these, 39% had taken one, two or three antihypertensive classes and had controlled BP (controlled hypertension [HTN]), 29% of them took one or two antihypertensive classes and had uncontrolled BP (uncontrolled HTN), and 32% of the patients took three antihypertensive classes or more and had uncontrolled BP (resistant HTN). The initiation of an antihypertensive drug and the factors affecting BP pressure were compared between the resistant and controlled HTN groups. Patients who initiated the study with ACEI were less likely to be resistant compared with those who started with alpha blockers and non-thiazide diuretics. Older patients, and high BMI tended to result in resistant HTN. In the second part of study, BP responses for patients who initiated the study with ACEI, ARB, BB, CCB and thiazide diuretics were compared. After adjusting for risk factors, patients who initiated the study with ACEI and ARB were more respondent than those who took CCB and thiazide diuretics. In the last part of this study, the association between BP reductions and factors affecting BP were tested for each antihypertensive drug. Older patients responded better to alpha blockers. Younger patients responded better to ACEI and ARB. An increase in BMI led to a decreased reduction in patients on ACEI and diuretics (thiazide and non-thiazide). An increase in albumin levels and a decrease in eGFR led to decreases in BP reductions in patients on thiazide diuretics. An increase in eGFR decreased the BP response with ACEI. In conclusion, although a high percentage of hypertensive patients in Scotland persisted with their initial drug prescription, low adherence rates were found with these patients. Approximately half of these patients required three different antihypertensive classes during the 5 years, and 32% of them had resistant HTN. Although this study was observational in nature, the large sample size in this study represented a real HTN population, and the large pharmacy data represented a real antihypertensive population, which were collected through the support of prescription data from the GBPC database. My findings suggest that ACEI, ARB and BB are less likely to require additional therapy. However, ACEI and ARB were better tolerated than BB in that they were more likely to be persistent than BB. In addition, users of ACEI, and ARB have good BP response and low resistant HTN. Linkage patients who participated in these studies with their morbidity and mortality will provide valuable information concerning the effect of adherence on morbidity and mortality and the potential benefits of using ACEI or ARB over other drugs.