Solution structure of the human signaling protein RACK1

Background: The adaptor protein RACK1 (receptor of activated kinase 1) was originally identified as an anchoring protein for protein kinase C. RACK1 is a 36 kDa protein, and is composed of seven WD repeats which mediate its protein-protein interactions. RACK1 is ubiquitously expressed and has been implicated in diverse cellular processes involving: protein translation regulation, neuropathological processes, cellular stress, and tissue development. Results: In this study we performed a biophysical analysis of human RACK1 with the aim of obtaining low resolution structural information. Small angle X-ray scattering (SAXS) experiments demonstrated that human RACK1 is globular and monomeric in solution and its low resolution structure is strikingly similar to that of an homology model previously calculated by us and to the crystallographic structure of RACK1 isoform A from Arabidopsis thaliana. Both sedimentation velocity and sedimentation equilibrium analytical ultracentrifugation techniques showed that RACK1 is predominantly a monomer of around 37 kDa in solution, but also presents small amounts of oligomeric species. Moreover, hydrodynamic data suggested that RACK1 has a slightly asymmetric shape. The interaction of RACK1 and Ki1/57 was tested by sedimentation equilibrium. The results suggested that the association between RACK1 and Ki-1/57(122-413) follows a stoichiometry of 1:1. The binding constant (KB) observed for RACK1-Ki-1/57(122-413) interaction was of around (1.5 +/- 0.2) x 10(6) M(-1) and resulted in a dissociation constant (KD) of (0.7 +/- 0.1) x 10(-6) M. Moreover, the fluorescence data also suggests that the interaction may occur in a cooperative fashion. Conclusion: Our SAXS and analytical ultracentrifugation experiments indicated that RACK1 is predominantly a monomer in solution. RACK1 and Ki-1/57(122-413) interact strongly under the tested conditions.

Low-Resolution Molecular Models Reveal the Oligomeric State of the PPAR and the Conformational Organization of Its Domains in Solution

The peroxisome proliferator-activated receptors (PPARs) regulate genes involved in lipid and carbohydrate metabolism, and are targets of drugs approved for human use. Whereas the crystallographic structure of the complex of full length PPAR gamma and RXR alpha is known, structural alterations induced by heterodimer formation and DNA contacts are not well understood. Herein, we report a small-angle X-ray scattering analysis of the oligomeric state of hPPAR gamma alone and in the presence of retinoid X receptor (RXR). The results reveal that, in contrast with other studied nuclear receptors, which predominantly form dimers in solution, hPPAR gamma remains in the monomeric form by itself but forms heterodimers with hRXR alpha. The low-resolution models of hPPAR gamma/RXR alpha complexes predict significant changes in opening angle between heterodimerization partners (LBD) and extended and asymmetric shape of the dimer (LBD-DBD) as compared with X-ray structure of the full-length receptor bound to DNA. These differences between our SAXS models and the high-resolution crystallographic structure might suggest that there are different conformations of functional heterodimer complex in solution. Accordingly, hydrogen/deuterium exchange experiments reveal that the heterodimer binding to DNA promotes more compact and less solvent-accessible conformation of the receptor complex.

Molecular adaptability of nucleoside diphosphate kinase b from trypanosomatid parasites: stability, oligomerization and structural determinants of nucleotide binding

Nucleoside diphosphate kinases play a crucial role in the purine-salvage pathway of trypanosomatid protozoa and have been found in the secretome of Leishmania sp., suggesting a function related to host-cell integrity for the benefit of the parasite. Due to their importance for housekeeping functions in the parasite and by prolonging the life of host cells in infection, they become an attractive target for drug discovery and design. In this work, we describe the first structural characterization of nucleoside diphosphate kinases b from trypanosomatid parasites (tNDKbs) providing insights into their oligomerization, stability and structural determinants for nucleotide binding. Crystallographic studies of LmNDKb when complexed with phosphate, AMP and ADP showed that the crucial hydrogen-bonding residues involved in the nucleotide interaction are fully conserved in tNDKbs. Depending on the nature of the ligand, the nucleotide-binding pocket undergoes conformational changes, which leads to different cavity volumes. SAXS experiments showed that tNDKbs, like other eukaryotic NDKs, form a hexamer in solution and their oligomeric state does not rely on the presence of nucleotides or mimetics. Fluorescence-based thermal-shift assays demonstrated slightly higher stability of tNDKbs compared to human NDKb (HsNDKb), which is in agreement with the fact that tNDKbs are secreted and subjected to variations of temperature in the host cells during infection and disease development. Moreover, tNDKbs were stabilized upon nucleotide binding, whereas HsNDKb was not influenced. Contrasts on the surface electrostatic potential around the nucleotide-binding pocket might be a determinant for nucleotide affinity and protein stability differentiation. All these together demonstrated the molecular adaptation of parasite NDKbs in order to exert their biological functions intra-parasite and when secreted by regulating ATP levels of host cells.

Macromolecular assembly of polycystin-2 intracytosolic C-terminal domain

Mutations in PKD2 are responsible for approximately 15% of the autosomal dominant polycystic kidney disease cases. This gene encodes polycystin-2, a calcium-permeable cation channel whose C-terminal intracytosolic tail (PC2t) plays an important role in its interaction with a number of different proteins. In the present study, we have comprehensively evaluated the macromolecular assembly of PC2t homooligomer using a series of biophysical and biochemical analyses. Our studies, based on a new delimitation of PC2t, have revealed that it is capable of assembling as a homotetramer independently of any other portion of the molecule. Our data support this tetrameric arrangement in the presence and absence of calcium. Molecular dynamics simulations performed with a modified all-atoms structure-based model supported the PC2t tetrameric assembly, as well as how different populations are disposed in solution. The simulations demonstrated, indeed, that the best-scored structures are the ones compatible with a fourfold oligomeric state. These findings clarify the structural properties of PC2t domain and strongly support a homotetramer assembly of PC2.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Camptosemin, a tetrameric lectin of Camptosema ellipticum: structural and functional analysis

Lectins have been classified into a structurally diverse group of proteins that bind carbohydrates and glycoconjugates with high specificity. They are extremely useful molecules in the characterization of saccharides, as drug delivery mediators, and even as cellular surface makers. In this study, we present camptosemin, a new lectin from Camptosema ellipticum. It was characterized as an N-acetyl-d-galactosamine-binding homo-tetrameric lectin, with a molecular weight around 26 kDa/monomers. The monomers were stable over a wide range of pH values and exhibited pH-dependent oligomerization. Camptosemin promoted adhesion of breast cancer cells and hemagglutination, and both activities were inhibited by its binding of sugar. The stability and unfolding/folding behavior of this lectin was characterized using fluorescence and far-UV circular dichroism spectroscopies. The results indicate that chemical unfolding of camptosemin proceeds as a two-state monomer-tetramer process. In addition, small-angle X-ray scattering shows that camptosemin behaves as a soluble and stable homo-tetramer molecule in solution.

Mode of operation and low-resolution structure of a multi-domain and hyperthermophilic endo-beta-1,3-glucanase from Thermotoga petrophila

1,3-beta-Glucan depolymerizing enzymes have considerable biotechnological applications including biofuel production, feedstock-chemicals and pharmaceuticals. Here we describe a comprehensive functional characterization and low-resolution structure of a hyperthermophilic laminarinase from Thermotoga petrophila (TpLam). We determine TpLam enzymatic mode of operation, which specifically cleaves internal beta-1,3-glucosidic bonds. The enzyme most frequently attacks the bond between the 3rd and 4th residue from the non-reducing end, producing glucose, laminaribiose and laminaritriose as major products. Far-UV circular dichroism demonstrates that TpLam is formed mainly by beta structural elements, and the secondary structure is maintained after incubation at 90 degrees C. The structure resolved by small angle X-ray scattering, reveals a multi-domain structural architecture of a V-shape envelope with a catalytic domain flanked by two carbohydrate-binding modules. Crown Copyright (C) 2011 Published by Elsevier Inc. All rights reserved.

Structure of the haptoglobin-haemoglobin complex

Red cell haemoglobin is the fundamental oxygen-transporting molecule in blood, but also a potentially tissue-damaging compound owing to its highly reactive haem groups. During intravascular haemolysis, such as in malaria and haemoglobinopathies(1), haemoglobin is released into the plasma, where it is captured by the protective acute-phase protein haptoglobin. This leads to formation of the haptoglobin-haemoglobin complex, which represents a virtually irreversible non-covalent protein-protein interaction(2). Here we present the crystal structure of the dimeric porcine haptoglobin-haemoglobin complex determined at 2.9 angstrom resolution. This structure reveals that haptoglobin molecules dimerize through an unexpected beta-strand swap between two complement control protein (CCP) domains, defining a new fusion CCP domain structure. The haptoglobin serine protease domain forms extensive interactions with both the alpha- and beta-subunits of haemoglobin, explaining the tight binding between haptoglobin and haemoglobin. The haemoglobin-interacting region in the alpha beta dimer is highly overlapping with the interface between the two alpha beta dimers that constitute the native haemoglobin tetramer. Several haemoglobin residues prone to oxidative modification after exposure to haem-induced reactive oxygen species are buried in the haptoglobin-haemoglobin interface, thus showing a direct protective role of haptoglobin. The haptoglobin loop previously shown to be essential for binding of haptoglobin-haemoglobin to the macrophage scavenger receptor CD163 (ref. 3) protrudes from the surface of the distal end of the complex, adjacent to the associated haemoglobin alpha-subunit. Small-angle X-ray scattering measurements of human haptoglobin-haemoglobin bound to the ligand-binding fragment of CD163 confirm receptor binding in this area, and show that the rigid dimeric complex can bind two receptors. Such receptor cross-linkage may facilitate scavenging and explain the increased functional affinity of multimeric haptoglobin-haemoglobin for CD163 (ref. 4).

Determination of the molecular weight of proteins in solution from a single small-angle X-ray scattering measurement on a relative scale

This paper describes a new and simple method to determine the molecular weight of proteins in dilute solution, with an error smaller than similar to 10%, by using the experimental data of a single small-angle X-ray scattering (SAXS) curve measured on a relative scale. This procedure does not require the measurement of SAXS intensity on an absolute scale and does not involve a comparison with another SAXS curve determined from a known standard protein. The proposed procedure can be applied to monodisperse systems of proteins in dilute solution, either in monomeric or multimeric state, and it has been successfully tested on SAXS data experimentally determined for proteins with known molecular weights. It is shown here that the molecular weights determined by this procedure deviate from the known values by less than 10% in each case and the average error for the test set of 21 proteins was 5.3%. Importantly, this method allows for an unambiguous determination of the multimeric state of proteins with known molecular weights.

ITERATIVE NUMERICAL-SOLUTION OF SCATTERING PROBLEMS

An iterative Neumann series method, employing a real auxiliary scattering integral equation, is used to calculate scattering lengths and phase shifts for the atomic Yukawa and exponential potentials. For these potentials the original Neumann series diverges. The present iterative method yields results that are far better, in convergence, stability and precision, than other momentum space methods. Accurate result is obtained in both cases with an estimated error of about 1 in 10(10) after some 8-10 iterations.

The subdomain structure of human serum albumin in solution under different pH conditions studied by small angle X-ray scattering

Small-angle X-ray scattering (SAXS) was used to study structural characteristics of human serum albumin (HSA) in solution under different pH conditions. Guinier analysis of SAXS results yielded values of the molecular radius of gyration ranging from 26.7 Å to 34.5 Å for pH varying from 2.5 to 7.0. This suggests the existence of significant differences in the overall shape of the molecule at different pH. Molecular models based on subdomains with different spatial configurations were proposed. The distance distribution functions associated with these models were calculated and compared with those determined from the experimental SAXS intensity functions. The conclusion of this SAXS study is that the arrangement of molecular subdomains is clearly pH dependent; the molecule adopting more or less compact configuration for different pH conditions. The conclusions of this systematic study on the modification in molecular shape of HSA as a response to pH changes is consistent with those of previous investigations performed for particular pH conditions.

A canonical UTD solution for electromagnetic scattering by an electrically large impedance circular cylinder illuminated by an obliquely incident plane wave

A uniform geometrical theory of diffraction (UTD) solution is developed for the canonical problem of the electromagnetic (EM) scattering by an electrically large circular cylinder with a uniform impedance boundary condition (IBC), when it is illuminated by an obliquely incident high frequency plane wave. A solution to this canonical problem is first constructed in terms of an exact formulation involving a radially propagating eigenfunction expansion. The latter is converted into a circumferentially propagating eigenfunction expansion suited for large cylinders, via the Watson transform, which is expressed as an integral that is subsequently evaluated asymptotically, for high frequencies, in a uniform manner. The resulting solution is then expressed in the desired UTD ray form. This solution is uniform in the sense that it has the important property that it remains continuous across the transition region on either side of the surface shadow boundary. Outside the shadow boundary transition region it recovers the purely ray optical incident and reflected ray fields on the deep lit side of the shadow boundary and to the modal surface diffracted ray fields on the deep shadow side. The scattered field is seen to have a cross-polarized component due to the coupling between the TEz and TMz waves (where z is the cylinder axis) resulting from the IBC. Such cross-polarization vanishes for normal incidence on the cylinder, and also in the deep lit region for oblique incidence where it properly reduces to the geometrical optics (GO) or ray optical solution. This UTD solution is shown to be very accurate by a numerical comparison with an exact reference solution.

Human Mitochondrial Hsp70 (mortalin): Shedding Light On Atpase Activity, Interaction With Adenosine Nucleotides, Solution Structure And Domain Organization.

The human mitochondrial Hsp70, also called mortalin, is of considerable importance for mitochondria biogenesis and the correct functioning of the cell machinery. In the mitochondrial matrix, mortalin acts in the importing and folding process of nucleus-encoded proteins. The in vivo deregulation of mortalin expression and/or function has been correlated with age-related diseases and certain cancers due to its interaction with the p53 protein. In spite of its critical biological roles, structural and functional studies on mortalin are limited by its insoluble recombinant production. This study provides the first report of the production of folded and soluble recombinant mortalin when co-expressed with the human Hsp70-escort protein 1, but it is still likely prone to self-association. The monomeric fraction of mortalin presented a slightly elongated shape and basal ATPase activity that is higher than that of its cytoplasmic counterpart Hsp70-1A, suggesting that it was obtained in the functional state. Through small angle X-ray scattering, we assessed the low-resolution structural model of monomeric mortalin that is characterized by an elongated shape. This model adequately accommodated high resolution structures of Hsp70 domains indicating its quality. We also observed that mortalin interacts with adenosine nucleotides with high affinity. Thermally induced unfolding experiments indicated that mortalin is formed by at least two domains and that the transition is sensitive to the presence of adenosine nucleotides and that this process is dependent on the presence of Mg2+ ions. Interestingly, the thermal-induced unfolding assays of mortalin suggested the presence of an aggregation/association event, which was not observed for human Hsp70-1A, and this finding may explain its natural tendency for in vivo aggregation. Our study may contribute to the structural understanding of mortalin as well as to contribute for its recombinant production for antitumor compound screenings.

Short-range structure of Pb(1-x)Ba(x)Zr(0.65)Ti(0.35)O(3) ceramic compounds probed by XAS and Raman scattering techniques

Ti K-edge x-ray absorption near-edge spectroscopy (XANES) and Raman scattering were used to study the solid solution effects on the structural and vibrational properties of Pb(1-x)Ba(x)Zr(0.65)Ti(0.35)O(3) with 0.0 < x < 0.40. Compared with x-ray diffraction techniques, which indicates that the average crystal symmetry changes with the substitution of Pb by Ba ions or with temperature variations for samples with x=0.00, 0.10, and 0.20, local structural probes such as XANES and Raman scattering results demonstrate that at local level, the symmetry changes are much less prominent. Theoretical XANES spectra calculation corroborate with the interpretation of the XANES experimental data.