X-ray and neutron scattering studies on some nanoscale structures in molecular biology

Scattering of X-rays and neutrons has been applied to the study of nanostructures with interesting biological functions. The systems studied were the protein calmodulin and its complexes, bacterial virus bacteriophage phi6, and the photosynthetic antenna complex from green sulfur bacteria, chlorosome. Information gathered using various structure determination methods has been combined to the low resolution information obtained from solution scattering. Conformational changes in calmodulin-ligand complex were studied by combining the directional information obtained from residual dipole couplings in nuclear magnetic resonance to the size information obtained from small-angle X-ray scattering from solution. The locations of non-structural protein components in a model of bacteriophage phi6, based mainly on electron microscopy, were determined by neutron scattering, deuterium labeling and contrast variation. New data are presented on the structure of the photosynthetic antenna complex of green sulfur bacteria and filamentous anoxygenic phototrophs, also known as the chlorosome. The X-ray scattering and electron cryomicroscopy results from this system are interpreted in the context of a new structural model detailed in the third paper of this dissertation. The model is found to be consistent with the results obtained from various chlorosome containing bacteria. The effect of carotenoid synthesis on the chlorosome structure and self-assembly are studied by carotenoid extraction, biosynthesis inhibition and genetic manipulation of the enzymes involved in carotenoid biosynthesis. Carotenoid composition and content are found to have a marked effect on the structural parameters and morphology of chlorosomes.

Low-Resolution Molecular Models Reveal the Oligomeric State of the PPAR and the Conformational Organization of Its Domains in Solution

The peroxisome proliferator-activated receptors (PPARs) regulate genes involved in lipid and carbohydrate metabolism, and are targets of drugs approved for human use. Whereas the crystallographic structure of the complex of full length PPAR gamma and RXR alpha is known, structural alterations induced by heterodimer formation and DNA contacts are not well understood. Herein, we report a small-angle X-ray scattering analysis of the oligomeric state of hPPAR gamma alone and in the presence of retinoid X receptor (RXR). The results reveal that, in contrast with other studied nuclear receptors, which predominantly form dimers in solution, hPPAR gamma remains in the monomeric form by itself but forms heterodimers with hRXR alpha. The low-resolution models of hPPAR gamma/RXR alpha complexes predict significant changes in opening angle between heterodimerization partners (LBD) and extended and asymmetric shape of the dimer (LBD-DBD) as compared with X-ray structure of the full-length receptor bound to DNA. These differences between our SAXS models and the high-resolution crystallographic structure might suggest that there are different conformations of functional heterodimer complex in solution. Accordingly, hydrogen/deuterium exchange experiments reveal that the heterodimer binding to DNA promotes more compact and less solvent-accessible conformation of the receptor complex.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Camptosemin, a tetrameric lectin of Camptosema ellipticum: structural and functional analysis

Lectins have been classified into a structurally diverse group of proteins that bind carbohydrates and glycoconjugates with high specificity. They are extremely useful molecules in the characterization of saccharides, as drug delivery mediators, and even as cellular surface makers. In this study, we present camptosemin, a new lectin from Camptosema ellipticum. It was characterized as an N-acetyl-d-galactosamine-binding homo-tetrameric lectin, with a molecular weight around 26 kDa/monomers. The monomers were stable over a wide range of pH values and exhibited pH-dependent oligomerization. Camptosemin promoted adhesion of breast cancer cells and hemagglutination, and both activities were inhibited by its binding of sugar. The stability and unfolding/folding behavior of this lectin was characterized using fluorescence and far-UV circular dichroism spectroscopies. The results indicate that chemical unfolding of camptosemin proceeds as a two-state monomer-tetramer process. In addition, small-angle X-ray scattering shows that camptosemin behaves as a soluble and stable homo-tetramer molecule in solution.

Mode of operation and low-resolution structure of a multi-domain and hyperthermophilic endo-beta-1,3-glucanase from Thermotoga petrophila

1,3-beta-Glucan depolymerizing enzymes have considerable biotechnological applications including biofuel production, feedstock-chemicals and pharmaceuticals. Here we describe a comprehensive functional characterization and low-resolution structure of a hyperthermophilic laminarinase from Thermotoga petrophila (TpLam). We determine TpLam enzymatic mode of operation, which specifically cleaves internal beta-1,3-glucosidic bonds. The enzyme most frequently attacks the bond between the 3rd and 4th residue from the non-reducing end, producing glucose, laminaribiose and laminaritriose as major products. Far-UV circular dichroism demonstrates that TpLam is formed mainly by beta structural elements, and the secondary structure is maintained after incubation at 90 degrees C. The structure resolved by small angle X-ray scattering, reveals a multi-domain structural architecture of a V-shape envelope with a catalytic domain flanked by two carbohydrate-binding modules. Crown Copyright (C) 2011 Published by Elsevier Inc. All rights reserved.

Structure of the haptoglobin-haemoglobin complex

Red cell haemoglobin is the fundamental oxygen-transporting molecule in blood, but also a potentially tissue-damaging compound owing to its highly reactive haem groups. During intravascular haemolysis, such as in malaria and haemoglobinopathies(1), haemoglobin is released into the plasma, where it is captured by the protective acute-phase protein haptoglobin. This leads to formation of the haptoglobin-haemoglobin complex, which represents a virtually irreversible non-covalent protein-protein interaction(2). Here we present the crystal structure of the dimeric porcine haptoglobin-haemoglobin complex determined at 2.9 angstrom resolution. This structure reveals that haptoglobin molecules dimerize through an unexpected beta-strand swap between two complement control protein (CCP) domains, defining a new fusion CCP domain structure. The haptoglobin serine protease domain forms extensive interactions with both the alpha- and beta-subunits of haemoglobin, explaining the tight binding between haptoglobin and haemoglobin. The haemoglobin-interacting region in the alpha beta dimer is highly overlapping with the interface between the two alpha beta dimers that constitute the native haemoglobin tetramer. Several haemoglobin residues prone to oxidative modification after exposure to haem-induced reactive oxygen species are buried in the haptoglobin-haemoglobin interface, thus showing a direct protective role of haptoglobin. The haptoglobin loop previously shown to be essential for binding of haptoglobin-haemoglobin to the macrophage scavenger receptor CD163 (ref. 3) protrudes from the surface of the distal end of the complex, adjacent to the associated haemoglobin alpha-subunit. Small-angle X-ray scattering measurements of human haptoglobin-haemoglobin bound to the ligand-binding fragment of CD163 confirm receptor binding in this area, and show that the rigid dimeric complex can bind two receptors. Such receptor cross-linkage may facilitate scavenging and explain the increased functional affinity of multimeric haptoglobin-haemoglobin for CD163 (ref. 4).

Evidence of clustering in an aqueous electrolyte solution: a small-angle X-ray scattering study

The work reported hen was motivated by a desire to verify the existence of structure - specifically MP-rich clusters induced by sodium bromide (NaBr) in the ternary liquid mixture 3-methylpyridine (Mf) + water(W) + NaBr. We present small-angle X-ray scattering (SAXS) measurements in this mixture. These measurements were obtained at room temperature (similar to 298 K) in the one-phase region (below the relevant lower consolute points, T(L)s) at different values of X (i.e., X = 0.02 - 0.17), where X is the weight fraction of NaBr in the mixture. Cluster-size distribution, estimated on the assumption that the clusters are spherical, shows systematic behaviour in that the peak of the distribution shifts rewards larger values of cluster radius as X increases. The largest spatial extent of the clusters (similar to 4.5 nm) is seen at X = 0.17. Data analysis assuming arbitrary shapes and sizes of clusters gives a limiting value of cluster size (- 4.5 nm) that is not very sensitive to X. It is suggested that the cluster size determined may not be the same as the usual critical-point fluctuations far removed from the critical point (T-L). The influence of the additional length scale due to clustering is discussed from the standpoint of crossover from Ising to mean-field critical behaviour, when moving away from the T-L.

Geometry and quadratic nonlinearity of charge transfer complexes in solution using depolarized hyper-Rayleigh scattering

We report large quadratic nonlinearity in a series of 1:1 molecular complexes between methyl substituted benzene donors and quinone acceptors in solution. The first hyperpolarizability, beta(HRS), which is very small for the individual components, becomes large by intermolecular charge transfer (CT) interaction between the donor and the acceptor in the complex. In addition, we have investigated the geometry of these CT complexes in solution using polarization resolved hyper-Rayleigh scattering (HRS). Using linearly (electric field vector along X direction) and circularly polarized incident light, respectively, we have measured two macroscopic depolarization ratios D = I-2 omega,I-X,I-X/I-2 omega,I-Z,I-X and D' = I-2 omega,I-X,I-C/I-2 omega,I-Z,I-C in the laboratory fixed XYZ frame by detecting the second harmonic scattered light in a polarization resolved fashion. The experimentally obtained first hyperpolarizability, beta(HRS), and the value of macroscopic depolarization ratios, D and D', are then matched with the theoretically deduced values from single and double configuration interaction calculations performed using the Zerner's intermediate neglect of differential overlap self-consistent reaction field technique. In solution, since several geometries are possible, we have carried out calculations by rotating the acceptor moiety around three different axes keeping the donor molecule fixed at an optimized geometry. These rotations give us the theoretical beta(HRS), D and D' values as a function of the geometry of the complex. The calculated beta(HRS), D, and D' values that closely match with the experimental values, give the dominant equilibrium geometry in solution. All the CT complexes between methyl benzenes and chloranil or 1,2-dichloro-4,5-dicyano-p-benzoquinone investigated here are found to have a slipped parallel stacking of the donors and the acceptors. Furthermore, the geometries are staggered and in some pairs, a twist angle as high as 30 degrees is observed. Thus, we have demonstrated in this paper that the polarization resolved HRS technique along with theoretical calculations can unravel the geometry of CT complexes in solution. (C) 2011 American Institute of Physics. doi:10.1063/1.3514922]

On the solution of the problem of scattering of surface water waves by a sharp discontinuity in the surface boundary conditions

Closed-form analytical expressions are derived for the reflection and transmission coefficients for the problem of scattering of surface water waves by a sharp discontinuity in the surface-boundary-conditions, for the case of deep water. The method involves the use of the Havelock-type expansion of the velocity potential along with an analysis to solve a Carleman-type singular integral equation over a semi-infinite range. This method of solution is an alternative to the Wiener-Hopf technique used previously.

Structure of the Pyridine-Chloranil Complex in Solution: A Surprise from Depolarized Hyper-Rayleigh Scattering Measurements

In this article, we report the structure of a 1:1 charge transfer complex between pyridine (PYR) and chloranil (CHL) in solution (CHCl(3)) from the measurement of hyperpolarizability (beta(HRS)) and linear and circular depolarization ratios, D and D', respectively, by the hyper-Rayleigh scattering technique and state-of-the-art quantum chemical calculations. Using linearly (electric field vector along X) and circularly polarized incident light, respectively, we have measured two macroscopic depolarization ratios D = I(X,X)(2 omega)/I(X,Z)(2 omega) and D' = I(X,C)(2 omega)/I(Z,C)(2 omega) in the laboratory fixed XYZ frame by detecting the second harmonic (SH) scattered light in a polarization resolved fashion. The stabilization energy and the optical gap calculated through the MP2/cc-pVDZ method using Gaussian09 were not significantly different to distinguish between the cofacial and T-shape structures. Only when the experimentally obtained beta(HRS) and the depolarization ratios, D and D', were matched with the theoretically computed values from single and double configuration interaction (SDCI) calculations performed using the ZINDO-SCRF technique, we concluded that the room temperature equilibrium structure of the complex is cofacial. This is in sharp contrast to an earlier theoretical prediction of the T-shape structure of the complex.

Solution of a class of surface water wave scattering problems involving non-reflecting vertical barriers

A large class of scattering problems of surface water waves by vertical barriers lead to mixed boundary value problems for Laplace equation. Specific attentions are paid, in the present article, to highlight an analytical method to handle this class of problems of surface water wave scattering, when the barriers in question are non-reflecting in nature. A new set of boundary conditions is proposed for such non-reflecting barriers and tile resulting boundary value problems are handled in the linearized theory of water waves. Three basic poblems of scattering by vertical barriers are solved. The present new theory of non-reflecting vertical barriers predict new transmission coefficients and tile solutions of tile mathematical problems turn out to be extremely simple and straight forward as compared to the solution for other types of barriers handled previously.

The structure and the dynamics of poly(vinyl methyl ether) PVME and in PVME concentrated water solution : a study by neutron scattering and fully atomistic molecular dynamics simulations

175 p. : il.

Surface-enhanced Raman scattering studies on aggregated silver nanoplates in aqueous solution

Four different sizes of citrate-protected silver nanoplates with the corresponding in-plane dipole resonance band at 530, 619, 778, and 858 nm, respectively, are synthesized for surface-enhanced Raman scattering (SERS) study. Their aggregation behaviors are monitored by use of UV-vis spectroscopy. During the aggregation process, a marked red shift of the in-plane dipole resonance of silver nanoplates is observed, whereas other resonance modes of them only have small alterations in the site or intensity. Aggregated silver nanoplates can serve as active SERS substrates with an enhancement factor of about 4.5 x 10(5) using 2-aminothiophenol as a probing molecule. The SERS performance of silver nanoplates is even superior to the commonly used Lee-Meisel silver colloid, making them very attractive for SERS applications.

Laser light scattering studies of soluble high-performance polyimides: Solution properties and molar mass distributions

Two soluble high-performance polyimides, poly(BCPOBDA/DMMDA) and poly(ODPA/DMMDA), in CHCl3 at 25 degrees C have been studied using laser light scattering. We found that the z-average radius of gyration ([R(g)]) can be scaled to the weight-average molecular weight (M(w)) as [R(g)] (nm) = 4.95 x 10(-2)M(w)(0.52) and [R(g)] (nm) = 1.25 x 10(-2)M(w)(0.66) respectively for poly(BCPOBDA/DMMDA) and poly(ODPA/DMMDA), indicating that poly(ODPA/DMMDA) in CHCl3 at 25 degrees C has a more extended chain conformation than poly(BCPOBDA/DMMDA). Using the wormlike chain model approach, we found that the Flory characteristic ratios (C*) of poly(BCPOBDA/DMMDA) and poly(ODPA/DMMDA) are similar to 20 and similar to 31, respectively, indicating that both of them have a slightly extended chain conformation in comparison with typical flexible polymer chains, such as polystyrene, whose C-infinity is similar to 10. A combination of the weight-average molar mass (M(w)) with the translational diffusion coefficient distributions (G(D)) has led to D (cm(2)/s) = 3.53 x 10(-4)M(-0.579) and D (cm(2)/s) = 4.30 x 10(-4)M(-0.613) respectively for two soluble high-performance polyimides, poly(BCPOBDA/DMMDA) and poly(ODPA/DMMTA), in CHCl3 at 25 degrees C. Using these two calibrations, we have successfully characterized the molar mass distributions of the two polyimides from their corresponding G(D)s. The exponents of these two calibrations further confirm that both of the polyimides have a slightly extended coil chain conformation in CHCl3. The chain flexibility difference between these two polyimides has also been discussed.

A DYNAMIC LASER LIGHT-SCATTERING STUDY OF CHITOSAN IN AQUEOUS-SOLUTION

The solution behavior of four chitosans (91% deacetylated chitin) with different molecular weights in 0.2M CH3COOH/0.1M CH3COONa aqueous solution was investigated at 25 degrees C by dynamic laser light scattering (LLS). The Laplace inversion of the precisely measured intensity-intensity time correlation function leads us to an estimate of the line-width distribution G(Gamma), which could be further reduced to a translational diffusion coefficient distribution G(D). By using a combination of static and dynamic LLS results, i.e. Mw and G(D), we were able to establish a calibration of D = k(D)M(-alpha D) with k(D) = (3.14 +/- 0.20) X 10(-4) and alpha(D) = 0.655 +/- 0.015. By using this calibration, we successfully converted G(D) into a molecular weight distribution f(w)(M). The larger alpha(D) value confirms that the chitosan chain is slightly extended in aqueous solution even in the presence of salts. This is mainly due to its backbone and polyelectrolytes nature. As a very sensitive technique, our dynamic LLS results also revealed that even in dilute solution chitosan still forms a small amount of larger sized aggregates that have ben overlooked in previous studies. The calibration obtained in this study will provide another way to characterize the molecular weight distribution of chitosan in aqueous solution at room temperature. (C) 1995 John Wiley & Sons, Inc.