132 resultados para SHRNA
Resumo:
Hematopoietic stem cells (HSC) are probably the best understood somatic stem cells and often serve as a paradigm for other stem cells. Nevertheless, most current techniques to genetically manipulate them in vivo are either constitutive and/or induced in settings of hematopoietic stress such as after irradiation. Here, we present a conditional expression system that allows for externally controllable transgenesis and knockdown in resident HSCs, based on a lentiviral vector containing a tet-O sequence and a transgenic mouse line expressing a doxycyclin-regulated tTR-KRAB repressor protein. HSCs harvested from tTR-KRAB mice are transduced with the lentiviral vector containing a cDNA (i.e., Green Fluorescent Protein (GFP)) and/or shRNA (i.e., p53) of interest and then transplanted into lethally irradiated recipients. While the vector is effectively repressed by tTR-KRAB during homing and engraftment, robust GFP/shp53 expression is induced on doxycyclin treatment in HSCs and their progeny. Doxycylin-controllable transcription is maintained on serial transplantation, indicating that repopulating HSCs are stably modified by this approach. In summary, this easy to implement conditional system provides inducible and reversible overexpression or knock down of genes in resident HSCs in vivo using a drug devoid of toxic or activating effects.
Resumo:
VEGF plays an essential role in ocular angiogenic diseases including the late-stage form of AMD, the primary cause of vision loss in the western world. Over-expression of VEGF leads to development of vasculature emanating from the choroid, invading the subretinal space through breaks in Bruch's membrane. Strategies leading to long-term suppression of inappropriate ocular angiogenesis are required. A panel of 10 shRNAs targeting the coding region of human VEGF165 was tested in HEK293 cells and in the human retinal pigment epithelial cell line, ARPE-19. VEGF knock-down up to 92% was achieved by co-transfecting shRNAexpressing constructs with plasmid encoding the Renilla luciferase gene fused to the VEGF165 sequence. For in vivo delivery of the most potent shRNA cassette, both single-stranded and self-complementary rAAV vectors were packaged in serotype 8 capsids. Intramuscular administration in mice led to localized expression and 96% knock-down of endogenous VEGF. Using eGFP as a marker, efficient gene transfer of retinal pigment epithelial cells, the cells thought to be responsible for the abnormal VEGF production, was obtained by subretinal delivery of rAAV2.8 vectors. The capacity of rAAV-encoded shRNAs to silence endogenous VEGF gene expression was evaluated in the laser-induced murine model of choroidal neovascularization (CNV). In this mouse model of AMD, sizes of the CNV were found to be significantly reduced following rAAV-shRNA subretinal delivery. Thus, our results indicate that gene transfer combining AAV-mediated delivery with triggering of the endogenous RNAi pathway can be used for anti-VEGF therapy and holds great promise for the treatment of AMD.
Resumo:
Dose-escalated radiation therapy for localized prostate cancer (PCa) has a clear therapeutic benefit; however, escalated doses may also increase injury to noncancerous tissues. Radiosensitizing agents can improve ionizing radiation (IR) potency, but without targeted delivery, these agents will also sensitize surrounding normal tissues. Here we describe the development of prostate-targeted RNAi agents that selectively sensitized prostate-specific membrane antigen–positive (PSMA-positive) cells to IR. siRNA library screens identified DNA-activated protein kinase, catalytic polypeptide (DNAPK) as an ideal radiosensitization target. DNAPK shRNAs, delivered by PSMA-targeting RNA aptamers, selectively reduced DNAPK in PCa cells, xenografts, and human prostate tissues. Aptamer-targeted DNAPK shRNAs, combined with IR, dramatically and specifically enhanced PSMA-positive tumor response to IR. These findings support aptamer-shRNA chimeras as selective sensitizing agents for the improved treatment of high-risk localized PCa.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Myostatin is described as a negative regulator of the skeletal muscle growth. Genetic engineering, in order to produce animals with double the muscle mass and that can transmit the characteristic to future progeny, may be useful. In this context, the present study aimed to analyse the feasibility of lentiviral-mediated delivery of short hairpin RNA (shRNA) targeting of myostatin into in vitro produced transgenic bovine embryos. Lentiviral vectors were used to deliver a transgene that expressed green fluorescent protein (GFP) and an shRNA that targeted myostatin. Vector efficiency was verified through in vitro murine myoblast (C2C12) cell morphology after inductive differentiation and by means of real-time PCR. The lentiviral vector was microinjected into the perivitellinic space of in vitro matured oocytes. Non-microinjected oocytes were used as the control. After injection, oocytes were fertilized and cultured in vitro. Blastocysts were evaluated by epifluorescence microscopy. Results demonstrated that the vector was able to inhibit myostatin mRNA in C2C12 cells, as the transducted group had a less amount of myostatin mRNA after 72 h of differentiation (p < 0.05) and had less myotube formation than the non-transduced group (p < 0.05). There was no difference in cleavage and blastocyst rates between the microinjected and control groups. After hatching, 3.07% of the embryos exhibited GFP expression, indicating that they expressed shRNA targeting myostatin. In conclusion, we demonstrate that a lentiviral vector effectively performed shRNA myostatin gene knockdown and gene delivery into in vitro produced bovine embryos. Thus, this technique can be considered a novel option for the production of transgenic embryos and double muscle mass animals.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
ANKHD1 is highly expressed in human acute leukemia cells and potentially regulates multiple cellular functions through its ankyrin-repeat domains. In order to identify interaction partners of the ANKHD1 protein and its role in leukemia cells, we performed a yeast two-hybrid system screen and identified SIVA, a cellular protein known to be involved in proapoptotic signaling pathways. The interaction between ANKHD1 and SIVA was confirmed by co-imunoprecipitation assays. Using human leukemia cell models and lentivirus-mediated shRNA approaches, we showed that ANKHD1 and SIVA proteins have opposing effects. While it is known that SIVA silencing promotes Stathmin 1 activation, increased cell migration and xenograft tumor growth, we showed that ANKHD1 silencing leads to Stathmin 1 inactivation, reduced cell migration and xenograft tumor growth, likely through the inhibition of SIVA/Stathmin 1 association. In addition, we observed that ANKHD1 knockdown decreases cell proliferation, without modulating apoptosis of leukemia cells, while SIVA has a proapoptotic function in U937 cells, but does not modulate proliferation in vitro. Results indicate that ANKHD1 binds to SIVA and has an important role in inducing leukemia cell proliferation and migration via the Stathmin 1 pathway. ANKHD1 may be an oncogene and participate in the leukemia cell phenotype.
Resumo:
Mitochondria are involved in energy supply, signaling, cell death and cellular differentiation and have been implicated in several human diseases. Neks (NIMA-related kinases) represent a family of mammal protein kinases that play essential roles in cell-cycle progression, but other functions have recently been related. A yeast two-hybrid (Y2H) screen was performed to identify and characterize Nek5 interaction partners and the mitochondrial proteins Cox11, MTX-2 and BCLAF1 were retrieved. Apoptosis assay showed protective effects of stable hNek5 expression from Hek293-T's cell death after thapsigargin treatment (2μM). Nek5 silenced cells as well as cells expressing a kinase dead version of Nek5, displayed an increase in ROS formation after 4h of thapsigargin treatment. Mitochondrial respiratory chain activity was found decreased upon stable hNek5expression. Cells silenced for hNek5 on the other hand presented 1.7 fold increased basal rates of respiration, especially at the electrons transfer steps from TMPD to cytochrome c and at the complex II. In conclusion, our data suggest for the first time mitochondrial localization and functions for Nek5 and its participation in cell death and cell respiration regulation. Stable expression of hNek5 in Hek293T cells resulted in enhanced cell viability, decreased cell death and drug resistance, while depletion of hNek5by shRNA overcame cancer cell drug resistance and induced apoptosis in vitro. Stable expression of hNek5 also inhibits thapsigargin promoted apoptosis and the respiratory chain complex IV in HEK293T cells.
Resumo:
Background: Human T-lymphotropic virus 1 (HTLV-1) is associated with the T-cell malignancy known as adult T-cell leukemia! lymphoma (ATLL) and with a disorder called HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). Currently, the treatment of these diseases is based on symptom relief. RNA interference (RNAi) technology has been described as an efficient mechanism for development of new therapeutic methods. Thus, the aim of this study was to evaluate the inhibition of HTLV-1 structural proteins using short hairpin RNAs (shRNAs) expressed by non-viral vectors. Materials and Methods: Reporter plasmids that express enhanced green fluorescent protein-Gag (EGFP-Gag) and EGFP-Env fusion proteins and vectors that express shRNAs corresponding to the HTLV-1 gag and env genes were constructed. shRNA vectors and reporter plasmids were simultaneously transfected into HEK 293 cells. Results: Fluorescence microscopy, flow cytometry and real-time PCR showed that shRNAs were effective in inhibiting the fusion proteins. Conclusion: These shRNAs are effective against the expression of structural genes and may provide an approach to the development of new therapeutic agents.
Resumo:
In the course of attempting to define the bone ""secretome"" using a signal-trap screening approach, we identified a gene encoding a small membrane protein novel to osteoblasts. Although previously identified in silico as ifitm5, no localization or functional studies had been undertaken on this gene. We characterized the expression patterns and localization of this gene in vitro and in vivo and assessed its role in matrix mineralization in vitro. The bone specificity and shown role in mineralization led us to rename the gene bone restricted ifitm-like protein (Bril). Bril encodes a 14.8-kDa 1.34 arnino acid protein with two transmembrane domains. Northern blot analysis showed bone-specific expression with no expression in other embryonic or adult tissues. In situ hybridization and immunohistochemistry in mouse embryos showed expression localized on the developing bone. Screening of cell lines showed Bril expression to be highest in osteoblasts, associated with the onset of matrix maturation/mineralization, suggesting a role in bone formation. Functional evidence of a role in mineralization was shown by adenovirus-mediated Brit overexpression and lentivirus-mediated Bril shRNA knockdown in vitro. Elevated Bril resulted in dose-dependent increases in mineralization in UMR106 and rat primary osteoblasts. Conversely, knockdown of Bril in MC3T3 osteoblasts resulted in reduced mineralization. Thus, we identified Bril as a novel osteoblast protein and showed a role in mineralization, possibly identifying a new regulatory pathway in bone formation.
Resumo:
L'ubiquitination est une modification des protéines conservée, consistant en l'addition de résidus « ubiquitine » et régulant le destin cellulaire des protéines. La protéine « TRAF-interacting protein » TRAIP (ou TRIP) est une ligase E3 qui catalyse l'étape finale de l'ubiquitination. TRAIP est conservé dans l'évolution et est nécessaire au développement des organismes puisque l'ablation de TRAIP conduit à la mort embryonnaire aussi bien de la drosophile que de la souris. De plus, la réduction de l'expression de TRAIP dans des kératinocytes épidermiques humains réprime la prolifération cellulaire et induit un arrêt du cycle cellulaire en phase Gl, soulignant le lien étroit entre TRAIP et la prolifération cellulaire. Comme les mécanismes de régulation de la prolifération jouent un rôle majeur dans l'homéostasie de la peau, il est important de caractériser la fonction de TRAIP dans ces mécanismes. En utilisant des approches in vitro, nous avons déterminé que la protéine TRAIP est instable, modifiée par l'addition d'ubiquitine et ayant une demi-vie d'environ 4 heures. Nos analyses ont également révélé que l'expression de TRAIP est dépendante du cycle cellulaire, atteignant un pic d'expression en phase G2/M et que l'induction de son expression s'effectue principalement au cours de la transition Gl/S. Nous avons identifié le facteur de transcription E2F1 comme en étant le responsable, en régulant directement le promoteur de TRAIP. Aussi, TRAIP endogène ou surexprimée est surtout localisée au niveau du nucléole, une organelle nucléaire qui est désassemblée pendant la division cellulaire. Pour examiner la localisation subcellulaire de TRAIP pendant la mitose, nous avons imagé la protéine TRAIP fusionnée à une protéine fluorescente, à l'intérieur de cellules vivantes nommées HeLa, à l'aide d'un microscope confocal. Dans ces conditions, TRAIP est majoritairement localisée autour des chromosomes en début de mitose, puis est arrangée au niveau de l'ADN chromosomique en fin de mitose. La détection de TRAIP endogène à l'aide d'un anticorps spécifique a confirmé cette localisation. Enfin, l'inactivation de TRAIP dans les cellules HeLa par interférence ARN a inhibé leur capacité à s'arrêter en milieu de mitose. Nos résultats suggèrent que le mécanisme sous-jacent peut être lié au point de contrôle de l'assemblage du fuseau mitotique. - Ubiquitination of proteins is a post-translational modification which decides the cellular fate of the protein. The TRAF-interacting protein (TRAIP, TRIP) functions as an E3 ubiquitin ligase mediating addition of ubiquitin moieties to proteins. TRAIP interacts with the deubiquitinase CYLD, a tumor suppressor whose functional inactivation leads to skin appendage tumors. TRAIP is required for early embryonic development since removal of TRAIP either in Drosophila or mice by mutations or knock¬out is lethal due to aberrant regulation of cell proliferation and apoptosis. Furthermore, shRNA- mediated knock-down of TRAIP in human epidermal keratinocytes (HEK) repressed cell proliferation and induced a Gl/S phase block in the cell cycle. Additionally, TRAIP expression is strongly down- regulated during keratinocyte differentiation supporting the notion of a tight link between TRAIP and cell proliferation. We thus examined the biological functions of TRAIP in epithelial cell proliferation. Using an in vitro approach, we could determine that the TRAIP protein is unstable, modified by addition of ubiquitin moieties after translation and exhibits a half-life of 3.7+/-1-6 hours. Our analysis revealed that the TRAIP expression is modulated in a cell-cycle dependent manner, reaching a maximum expression level in G2/M phases. In addition, the expression of TRAIP was particularly activated during Gl/S phase transition and we could identify the transcription factor E2F1 as an activator of the TRAIP gene promoter. Both endogenous and over-expressed TRAIP mainly localized to the nucleolus, a nuclear organelle which is disassembled during cell division. To examine the subcellular localization of TRAIP during M phase, we performed confocal live-cell imaging of a functional fluorescent protein TRAIP-GFP in HeLa cells. TRAIP was distributed in the cytoplasm and accumulated around mitotic chromosomes in pro- and meta-phasic cells. TRAIP was then confined to chromosomal DNA location in anaphase and later phases of mitosis. Immune-detection of endogenous TRAIP protein confirmed its particular localization in mitosis. Finally, inactivating TRAIP expression in HeLa cells using RNA interference abrogated the cells ability to stop or delay mitosis progression. Our results suggested that TRAIP may involve the spindle assembly checkpoint.
Resumo:
Overexpression of the polycomb group protein enhancer of zeste homologue 2 (EZH2) occurs in diverse malignancies, including prostate cancer, breast cancer, and glioblastoma multiforme (GBM). Based on its ability to modulate transcription of key genes implicated in cell cycle control, DNA repair, and cell differentiation, EZH2 is believed to play a crucial role in tissue-specific stem cell maintenance and tumor development. Here, we show that targeted pharmacologic disruption of EZH2 by the S-adenosylhomocysteine hydrolase inhibitor 3-deazaneplanocin A (DZNep), or its specific downregulation by short hairpin RNA (shRNA), strongly impairs GBM cancer stem cell (CSC) self-renewal in vitro and tumor-initiating capacity in vivo. Using genome-wide expression analysis of DZNep-treated GBM CSCs, we found the expression of c-myc, recently reported to be essential for GBM CSCs, to be strongly repressed upon EZH2 depletion. Specific shRNA-mediated downregulation of EZH2 in combination with chromatin immunoprecipitation experiments revealed that c-myc is a direct target of EZH2 in GBM CSCs. Taken together, our observations provide evidence that direct transcriptional regulation of c-myc by EZH2 may constitute a novel mechanism underlying GBM CSC maintenance and suggest that EZH2 may be a valuable new therapeutic target for GBM management.
Resumo:
Dendritic growth is essential for the establishment of a functional nervous system. Among extrinsic signals that control dendritic development, substantial evidence indicates that BDNF regulates dendritic morphology. However, little is known about the underlying mechanisms by which BDNF controls dendritic growth. In this study, we show that the MAPK signaling pathway and the transcription factor cAMP response element-binding protein (CREB) mediate the effects of BDNF on dendritic length and complexity. However, phosphorylation of CREB alone is not sufficient for the stimulation of dendritic growth by BDNF. Thus, using a mutant form of CREB unable to bind CREB-regulated transcription coactivator (CRTC1), we demonstrate that this effect also requires a functional interaction between CREB and CRTC1. Moreover, inhibition of CRTC1 expression by shRNA-mediated knockdown abolished BDNF-induced dendritic growth of cortical neurons. Interestingly, we found that nuclear translocation of CRTC1 results from activation of NMDA receptors by glutamate, a process that is essential for the effects of BDNF on dendritic development. Together, these data identify a previously unrecognized mechanism by which CREB and the coactivator CRTC1 mediate the effects of BDNF on dendritic growth.
Resumo:
Summary : A large body of evidence indicates that the innate immune system plays a key role in host response to viral infection. Recently, Toll-like receptors (TLRs), RIG-I-like receptors (RLRs), and NOD-like receptor receptors (NLRs) have emerged as key innate immune sensors of microbial products, eliciting intracellular signaling and leading to the production of chemokines, cytokines and interferons (IFNs) that shape innate immune responses and coordinate the development of adaptive immunity. Poxviruses are currently developed as vaccines vectors for infectious diseases such as HIV, tuberculosis and malaria. Modified vaccinia virus Ankara (MVA) and New York vaccinia virus (NWAC) are attenuated, replication deficient strains of poxvirus. The mechanisms underlying innate immune responses to MVA and NYVAC are poorly characterized. Thus, the objectives of the project were to determine the innate immune profile stimulated by poxviruses in innate immune cells and to evaluate the impact of modifications in the viral genome on MVA and NYVAC immunogenicity. MVA stimulated the production of abundant amounts of chemokines and IFNß but low levels of cytokines by human macrophages. In contrast, NYVAC weakly stimulated the production of all mediators. Interestingly, MVA and NYVAC strongly stimulated innate immune responses in vivo and in human whole blood, suggesting that a soluble factors}, possibly a complement component, was required for optimal activation of innate immune cells by poxviruses. Modified MVA and NYVAC produced by single or multiple deletions of viral genes targeting crucial pathways of host innate immunity, and mutant poxviruses with limited replication capacity, increased the production of pro-inflammatory molecules by human whole blood. Gene expression profiling in human macrophages confirmed the increased immunologic stimulatory capacity of modified poxviruses. The pathways activated by MVA and NYVAC in innate immune cells were described by analysing the response of knockdown or shRNA transduced macrophages with impaired expression of TLRs and their adaptors (MyD8$ and TRIF), RLRs (RIG-I, MDA-5 and the adaptor IPS-1) and the NALP3 inflammasome composed óf the NLR NALP3, caspase-1 and ASC. These experiments revealed a critical role for TLR2-TLR6-MyD88 in the production of tFNß-independent chemokines and of MDA-5-IPS-1 in the production of IFNß and IFNßdependent chemokines. The transcription of the iL1b gene encoding for the IL-1ß cytokine was initiated through TLR2-MyD88, whereas the maturation and the secretion of IL-1ß were controlled by the NALP3 inflammasome. Finally, we analyzed the role of macrophage migration inhibitory factor (MIF), a mediator of inflammation and innate immune responses, in MVA infection. We observed that MVA infection increased MIF production by innate immune cells and that MIF deficiency impaired macrophage and dendritic cell responses (ie migration, maturation, cytokine and IFN production) to MVA infection in vitro and in vivo. Moreover, MIF-deficiency resulted in delayed anti-MVA specific antibody production in mice immunized with the virus. In conclusion, we demonstrate. that poxviruses can be modified genetically to improve their immunogenicity. We also report the first comprehensive analysis of poxvirus sensing by innate immune cells, showing that the TLR, RLR and NLR pathways play specific and coordinated roles in regulating cytokine, chemokine and IFN response to poxvirus infection. Finally, we show that MIF is an integral host component involved in innate and adaptive immune responses to MVA infection. The present findings provide important information relevant to the study of the pathogenesis of poxvirus infections and allow a better understanding of the immunogenic potential of vaccine vectors, which is required for the development of optimized modìfied pox-vaccine vectors.
Resumo:
BACKGROUND: Human immunodeficiency virus (HIV) takes advantage of multiple host proteins to support its own replication. The gene ZNRD1 (zinc ribbon domain-containing 1) has been identified as encoding a potential host factor that influenced disease progression in HIV-positive individuals in a genomewide association study and also significantly affected HIV replication in a large-scale in vitro short interfering RNA (siRNA) screen. Genes and polymorphisms identified by large-scale analysis need to be followed up by means of functional assays and resequencing efforts to more precisely map causal genes. METHODS: Genotyping and ZNRD1 gene resequencing for 208 HIV-positive subjects (119 who experienced long-term nonprogression [LTNP] and 89 who experienced normal disease progression) was done by either TaqMan genotyping assays or direct sequencing. Genetic association analysis was performed with the SNPassoc package and Haploview software. siRNA and short hairpin RNA (shRNA) specifically targeting ZNRD1 were used to transiently or stably down-regulate ZNRD1 expression in both lymphoid and nonlymphoid cells. Cells were infected with X4 and R5 HIV strains, and efficiency of infection was assessed by reporter gene assay or p24 assay. RESULTS: Genetic association analysis found a strong statistically significant correlation with the LTNP phenotype (single-nucleotide polymorphism rs1048412; [Formula: see text]), independently of HLA-A10 influence. siRNA-based functional analysis showed that ZNRD1 down-regulation by siRNA or shRNA impaired HIV-1 replication at the transcription level in both lymphoid and nonlymphoid cells. CONCLUSION: Genetic association analysis unequivocally identified ZNRD1 as an independent marker of LTNP to AIDS. Moreover, in vitro experiments pointed to viral transcription as the inhibited step. Thus, our data strongly suggest that ZNRD1 is a host cellular factor that influences HIV-1 replication and disease progression in HIV-positive individuals.