Cytotoxicity of half sandwich ruthenium(II) complexes with strong hydrogen bond acceptor ligands and their mechanism of action

Neutral and cationic organometallic ruthenium(II) piano stool complexes of the type [(eta(6)-cymene)R-uCl(X)(Y)] (complexes R1-R8) has been synthesized and characterized. In cationic complexes, X, Y is either a eta(2) phosphorus ligand such as 1,1-bis(diphenylphosphino)methane (DPPM) and 1,2-bis(diphenylphosphino)ethane (DPPE) or partially oxidized ligands such as 1,2-bis(diphenylphosphino)methane monooxide (DPPMO) and 1,2-bis(diphenylphosphino)ethane monooxide (DPPEO) which are strong hydrogen bond acceptors. In neutral complexes. X is chloride and Y is a monodentate phosphorous donor. Complexes with DPPM and DPPMO ligands ([(eta(6)-cymene)Ru(eta(2)-DPPM)Cl]PF6 (R2), [(eta(6)-cymene)Ru(eta(2)-DPPMO)Cl]PF6 (R3), [(eta(6)-cymene)Ru(eta(1)-DPPM)Cl-2] (R5) and [(eta(6)-cymene)Ru(eta(1)-DPPMO)Cl-2] (R6) show good cytotoxicity. Growth inhibition study of several human cancer cell lines by these complexes has been carried out. Mechanistic studies for R5 and R6 show that inhibition of cancer cell growth involves both cell cycle arrest and apoptosis induction. Using an apoptosis PCR array, we identified the sets of antiapoptotic genes that were down regulated and pro-apoptotic genes that were up regulated. These complexes were also found to be potent metastasis inhibitors as they prevented cell invasion through matrigel. The complexes were shown to bind DNA in a non intercalative fashion and cause unwinding of plasmid DNA in cell-free medium by competitive ethidium bromide binding, viscosity measurements, thermal denaturation and gel mobility shift assays.

Syntheses, X-ray structure and properties of (5-cyclopentadienyl)ruthenium(II) complexes of pyridyl-2-hydrazone ligands

Complexes of the formulae [(-Cp)Ru(PPh3)(2-PPH)]Cl and [(Cp)Ru(PPh3) (py)(1-PPH)]Cl were prepared by reacting pyridyl-2-phenylhydrazone [PPH, C5H4N-2-CH=NNHPh] with (-Cp)Ru(PPh3)2Cl and (-Cp)Ru(PPh3)(py)Cl, respectively. In these complexes the PPH ligand displays bidentate chelating and unidentate modes of bonding. The molecular structure of [(-Cp)Ru(PPh3)(2-PPH)](ClO4)·CH2Cl2 was determined by X-ray crystallography. In this complex the metal is bonded to the N-pyridyl and N-imine atoms of the chelating ligand. 1H NMR spectral data suggests that PPH is bonded to ruthenium through the pyridine moiety of the PPH ligand in [(η-Cp)Ru(PPh3)(py)(η1-PPH)]Cl.

Substitution-Modulated Anticancer Activity of Half-Sandwich Ruthenium(II) Complexes with Heterocyclic Ancillary Ligands

Ten new organometallic half-sandwich ruthenium complexes with heterocyclic ligands have been synthesized (H1-H10). The substituents on the ancillary heterocyclic ligands were varied to understand the effect of substitution on anticancer activity. The crystallographic characterization of five complexes confirms that they adopt three-legged piano-stool structures and are stabilized by intramolecular hydrogen bonding. Complexes H2 and H3 also exhibit halogen bonding in the solid state. In aqueous media, the complexes form dinuclear ruthenium species. Complex H1 with a noncytotoxic heterocycle, 6-fluoro-2-mercaptobenzothiazole, and complex H11 with the unsubstituted 2-mercaptobenzothiazole are the most active against A2780 and KB cell lines. The substitution of the H atoms on the ancillary ligand with Cl or Br atoms leads to a decrease in the anticancer activity. With the exception of fluorine-substituted H5, the complexes with mercaptobenzoxazole (H6-H9) are inactive against all of the tested cell lines. Ruthenium complexes with mercaptonaphthimidazole (H10) and mercaptobenzimidazole (H13) do not show any anticancer activity. The active complexes show a biphasic melting curve when incubated with calf thymus (CT) DNA. These complexes only inhibit thioredoxin reductase (TrxR) enzyme activity to a small extent. The substitution of hydrogen atoms with fluorine atoms in the aromatic heterocyclic ligands on organometallic half-sandwich ruthenium complexes has the most beneficial effect on their anticancer activity.

Synthesis, characterization and reactivity studies of electrophilic ruthenium(II) complexes: a study of H-2 activation and labilization

Reaction of 2,2'-bipyridine (bpy) with dinuclear complexesRuCl(dfppe)(mu-Cl)(3)Ru(dmso-S)(3)](dfppe = 1,2-bis(dipentafluorophenyl phosphino)ethane (C6F5)(2)PCH2CH2P(C6F5)(2); dmso = dimethyl sulfoxide) (1) or RuCl(dfppe)(mu-Cl)(3)RuCl(dfppe)] (2) affords the mononuclear species trans-RuCl2(bpy)(dfppe)] (3). Using this precursor complex (3), a series of new cationic Ru(II) electrophilic complexes RuCl(L)(bpy)(dfppe)]Z] (L = P(OMe)(3) (5), PMe3 (6), CH3CN (7), CO (8), H2O (9); Z = OTf (5, 6, 7, 8), BAr4F (9) have been synthesized via abstraction of chloride by AgOTf or NaBAr4F in the presence of L. Complexes 5 and 6 were converted into the corresponding isomeric hydride derivatives RuH(PMe3)(bpy)(dfppe)]OTf] (10a, 10b) and RuH(P(OMe)(3))(bpy)(dfppe)]OTf] (11a, 11b) respectively, when treated with NaBH4. Protonation of the cationic monohydride complex (11a) with HOTf at low temperatures resulted in H-2 evolution accompanied by the formation of either solvent or triflate bound six coordinated species Ru(S)(P(OMe)(3))(bpy)(dfppe)]OTf](n) (S = solvent (n = 2), triflate (n = 1)] (13a/13b); these species have not been isolated and could not be established with certainty. They (13a/13b) were not isolated, instead the six-coordinated isomeric aqua complexes cis-(Ru(bpy)(dfppe)(OH2)(P(OMe)(3))]OTf](2) (14a/14b) were isolated. Reaction of the aqua complexes (14a/14b) with 1 atm of H-2 at room temperature in acetone-d(6) solvent resulted in heterolytic cleavage of the H-H bond. Results of the studies on H-2 lability and heterolytic activation using these complexes are discussed. The complexes 3, 5, 11a, and 14a have been structurally characterized.

Oligoaniline-Functionalized terpyridine ligands and their ruthenium(II) complexes: synthesis, spectroscopic property and redox behaviors

A series of oligoaniline-functionalized mono- and bis-topic terpyridine ligands, i.e. C6H5[N(R)C6H4](n)TPY (R = H, butyl, tert-butyloxycarbonyl; n = 1-4; TPY = 2,2':6',2"-terpyridyl) and TPYC6H4[N(R)C6H4](m)TPY (R = H, tert-butyloxycarbonyl; m = 2, 4), and the corresponding monoand bis-nuclear ruthenium(II) complexes have been synthesized and verified. The spectroscopic results indicate that two kinds of pi-pi* transitions from TPY and oligoaniline fragments of ligands strongly shift to lower energy, and the metal-to-ligand charge-transfer transition ((MLCT)-M-1) bands of all obtained complexes are considerably red-shifted (Delta lambda(max) = 22-64 nm) and their intensities become much more intense (approximately 4-6 times), compared with those of the reported complex [Ru(TPY)(2)](2+). Moreover, the spectroscopic properties of the ligands and complexes with longer oligoaniline units (n = 3, 4) are markedly influenced by the external stimulus, such as the oxidation and proton acid doping.

The efficient syntheses of three novel bridging phenanthroline ligands and their binuclear ruthenium(II) complexes

Three bridging ligands (L) and their binuclear phenanthroline ruthenium(II) complexes {[Ru(1,10-phenanthroline)(2)](2)(L)}(PF6)(4) were synthesized and characterized by IR, H-1 NMR, and elemental analysis, where L are 1,8-adipoylamido-bis(1,10-phenanthroline-5-yl) (L-1), 1,11-azelaoylamidobis(1, 10-phenanthroline-5-yl) (L-2), and p-phthaloylamido-bis(1,10-phenanthroline-5-yl) (L-3).

Synthesis, 2D NMR, electrochemistry and luminescence of ruthenium(II) complexes with 2,2 '-bipyridine and 5-(omega-bromoalkylamido)-1,10-phenanthroline

The efficient synthesis of 5-(5-bromovaleramido)-1,10-phenanthroline, 5-(6-bromohexanamido)-1,10-phenanthroline, and 5-(11-bromoundecanamido)-1,10-phenanthroline are described, which reacted with cis-Ru(bpy)(2)Cl-2. 2H(2)O and sodium hexafluorophosphate to form Ru(bpy)(2)[phen-NHCO(CH2)(n)Br](PF6)(2) (n = 4, 5 or 10; phen = 1,10-phenanthroline). The intricate H-1 NMR spectra at low field of these complexes were completely assigned in virtue of H-1-H-1 COSY technique. Cyclic voltammetry was used to study electrochemical behaviours of these complexes, and their luminescent properties were investigated with fluorescent spectra.

Characterisation of bifunctional ruthenium(ii) complexes, potential DNA photo-probes. Presence of folded and unfolded conformers

Novel bifunctional ruthenium(n) complexes, [Ru(TAP)2(POQ-Nmet)]2+ and [Ru(BPY)2(POQ-Nmet)]2+(la, 2a), containing a metallic and an organic moiety, have been prepared as photoprobes and photoreagents of DNA(TAP = 1,4,5,8-tetraazaphenanthrene, POQ-Nmet = 5-[6-(7-chloroquinolin-4-yl)-3-thia-6-azaheptanamido]-l,10phenanthroline). The ES mass spectrometry and 'H NMR data in organic solvents indicate that the quinoline moiety exists in both the protonated and non-protonated form. Moreover, the comparison of the NMR data with those of the corresponding monofunctional complexes(without quinoline) evidences that [Ru(TAP).2(POQ-Nmet)]2+ and [Ru(BPY)J(POQ-Nmet)]2+ are unfolded when the quinoline unit is protonated whereas deprotonation permits folding of the molecule. In the folded state the spatial proximity of the electron donor(the organic moiety) and electron acceptor(the metallic moiety) in [Ru(TAP)2(POQ-Nmet)]2+ favours intramolecular photo-induced electron transfer, which has been shown in a previous study to be responsible for the very low luminescence of la in non-protonating solutions. The restoration of the luminescence by protonation of the quinoline moiety as observed previously is in agreement with the unfolding of the molecule demonstrated in this work. The existence of such folding-unfolding processes related to protonation is crucial for studies of la with DNA. © The Royal Society of Chemistry 2000.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

The dichotomy in the DNA-binding behaviour of ruthenium(II) complexes bearing benzoxazole and benzothiazole groups

The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.

Sequential C-H and C-Ru bond formation and cleavage during the thermally induced rearrangement of aryl ruthenium(II) complexes with [C6H3(CH2NMe2)(2)-2,6](-) as a bidentate eta(2)-C,N coordinated ligand. The crystal structures of the isomeric pairs [RuCl{eta(6)-C10H14}{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,n}] (n = 4 or 6) and [Ru(eta(5)-C5H5){(eta(2)-C,N-C6H3(CH2NMe2)(2)-2,n} (PPH3)] (n = 4 or 6)

New air-stable ruthenium(II) complexes that contain the aryldiamine ligand [C6H3(CH2-NMe2)(2)-2,6](-) (NCN) are described. These complexes are [RuCl{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,6}(eta(6)-C10H14)] (2; C10H14 = p-cymene = C6H4Me-Pr-i-4), [Ru{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,6}(eta(5)-C5H5)(PPh3)] (5), and their isomeric forms [RuCl{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,4}(eta(6)-C10H14)] (3) and [Ru{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,4}(eta(5)-C5H5)(PPh3)] (6), respectively. Complex 2 has been prepared from the reaction of [Li(NCN)](2) with [RuCl2(eta(6)-C10H14)](2), whereas complex 5 has been prepared by the treatment of [RuCl{eta(3)-N,C,N-C6H3(CH2NMe2)(2)-2,6}(PPh3)] (4) with [Na(C5H5)](n). Both 2 and 5 are formally 18-electron ruthenium(II) complexes in which the monoanionic potentially tridentate coordinating ligand NCN is eta(2)-C,N-bonded, In solution (halocarbon solvent at room temperature or in aromatic solvents at elevated temperature), the intramolecular rearrangements of 2 and 5 afford complexes 3 and 6, respectively. This is a result of a shift of the metal-C-aryl bond from position-1 to position-3 on the aromatic ring of the NCN ligand. The mechanism of the isomerization is proposed to involve a sequence of intramolecular oxidative addition and reductive elimination reactions of both aromatic and aliphatic C-H bonds. This is based on results from deuterium labeling, spectroscopic studies, and some kinetic experiments. The mechanism is proposed to contain fully reversible steps in the case of 5, but a nonreversible step involving oxidative addition of a methyl NCH2-H bond in the case of 2. The solid-state structures of complexes 2, 3, 5, and 6 have been determined by single-crystal X-ray diffraction. A new dinuclear 1,4-phenylene-bridged bisruthenium(II) complex, [1,4-{RuCl(eta(6)-C10H14)}(2){C-6(CH2NMe2)(4)-2,3,5,6-C,N,C',N'}] (9) has also been prepared from the dianionic ligand [C-6(CH2NMe2)(4)-2,3,5,6](2-) (C2N4). The C2N4 ligand is in an eta(2)-C,N-eta(2)-C',N'-bis(bidentate) bonding mode. Compound 9 does not isomerize in solution (halocarbon solvent), presumably because of the absence of an accessible C-aryl-H bond. Complex 9 could not be isolated in an analytically pure form, probably because of its high sensitivity to air and very low solubility, which precludes recrystallization.

New ruthenium(II) complexes of functionalized monoanionic aryldiamine N,C,N'-terdentate ligands: Syntheses of [Ru-II{2,6-(Me(2)NCH(2))(2)-4-R-C6H2}(terpy)]Cl+(-); X-ray structure of a dimeric organolithium compound,[Li{2,6-(Me(2)NCH(2))(2)-4-Ph-C6H2}](2)

The new anionic functionalized aryldiamine ligands [2,6-(Me(2)NCH(2))(2)-4-R-C6H2](-) (R = Me(3)SiC=C, C6H5, Me(3)Si), formally derived from [2,6-(Me(2)NCH(2))(2)C6H3](-), have been prepared as their lithium compounds. The compound [Li{2,6-(Me(2)NCH(2))(2)-4-Ph-C6H2}](2) crystallizes in the monoclinic space group C2/c (no. 15) with a = 13.1225(5), b = 13.5844(7), c = 15.9859(12) Angstrom, beta = 105.329(5)degrees, V = 3264.0(3)Angstrom(3), Z = 4. The structure refinement converged to R(1) = 0.0374 for 2037 observed reflections [F-o>4 sigma(F-o)] and wR(2) = 0.0922 for 2560 unique data. The organolithium compounds have been used in transmetalation reactions to give the corresponding functionalized organoruthenium(II) complexes [Ru-II{2,6-(Me(2)NCH(2))(2)-4-R-C6H2}(terpy)]Cl-+(-) (terpy = 2,2';6',2 ''-terpyridine). The Ru-II species with R = HC = C has also been synthesized.

Versatile N,C,N coordination behavior of a monoanionic aryldiamine ligand in ruthenium(II) complexes: Syntheses and crystal structures of [Ru-II(C6H3(CH(2)NMe(2))(2)-2,6)X(L)] (L equals norbornadiene, X=Cl, SO3CF3; L=PPh(3), X=I) and [Ru-II{C6H3(CH(2)NMe(2))(2)-2,6}(2,2':6:2''-terpyridine)]Cl

The monoanionic ligand [C6H3(CH(2)NMe(2))(2)-2,6](-), a potentially terdentate N,C,N bonding system, has been employed to synthesize a series of new ruthenium(II) complexes [Ru{C6H3(CH(2)NMe(2))(2)-2,6}X(L)] (L = PPh(3) X = Cl (2a), I (2b); L = norbornadiene (nbd), X = Cl (4), eta(1)-OSO2CF3 (5)) and [Ru{C6H3(CH(2)NMe(2))(2)-2,6}(2,2':6',2 ''-terpyridine)]Cl (3). X-ray crystal structures of 2b and 3-5 have been determined, in which the N,C,N coordination geometry with respect to the metal center is found to differ considerably. In each complex the aryldiamine ligand is terdentate, eta(3)-N,C,N-bonded as a six electron donor system. However, depending on the other ligands in the Ru(II) coordination sphere, this ligand demonstrates considerable flexibility in adopting coordination geometries which range from meridional in 3 through pseudomeridional in 2b to pseudofacial in 4 and 5. In the structures of 4 and 5 significant distortions of the aryl ring, involving bending of the six-membered ring into a boatlike conformation, are found. The different combinations of the N,C,N ligand with sets of other ligands lead to a range of metal geometries, i.e. square pyramidal in 2b, octahedral in 3, and bicapped tetrahedral in 4 and 5.

Synthesis and structural characterization of new Piano-stool Ruthenium(II) complexes bearing 1-Butylimidazole heteroaromatic ligand

New cationic ruthenium(II) complexes with the formula [Ru(eta(5)-C5H5)(LL)(1-BuIm)] [Z], with (LL) = 2PPh(3) or DPPE, and Z = CF3SO3-, PF6-, BPh4-, have been synthesized and fully characterized. Spectroscopic and electrochemical studies revealed that the electronic properties of the coordinated 1-butylimidazole were clearly influenced by the nature of the phosphane coligands (LL) and also by the different counter ions. The solid state structures of the six complexes determined by X-ray crystallographic studies, confirmed the expected distorted three-legged piano stool structure. However the geometry of the 1-butylimidazole ligand was found considerably different in all six compounds, being governed by the stereochemistry of the mono and bidentate coligands (PPh3 or DPPE).