985 resultados para Regulatory Region


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The tandemly repeated 28-bp sequence in the 5'-terminal regulatory, region of human thymidylate synthase (TSER), which has been reported to be polymorphic in different populations, was surveyed in 668 Chinese from 9 Han groups, 8 ethnic populations, and 3

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Lunatic fringe (Lfng), one modulator of Notch signaling, plays an essential part in demarcation of tissues boundaries during animal early development, especially somitogenesis. To characterize the promoter of zebrafish 1fng and generate somite-specific transgenic zebrafish, we isolated the upstream regulatory region of zebrafish 1fng by blast search at the Ensembl genome database (http://www. ensembl.org) and analyzed the promoter activity using green fluorescent protein (GFP) as a reporter. Promoter activity assay in zebrafish shows that the 0.2-kb fragment containing GC-box, CAAT-box, and TATA-box can direct tissue-specific GFP expression, while the 0.4-kb and 1.2-kb fragments with further upstream sequence included drive GFP expression more efficiently. We produced 1fngEGFP-transgenic founders showing somite-specific expression of GFP and consequently generated a hemizygous 1fngEGFP-transgenic line. The eggs from 1fngEGFP-transgenic female zebrafish show strong GFP expression, which is consistent to the reverse-transcription polymerase chain reaction PCR (RT-PCR) detection of 1fng transcripts in the fertilized eggs. This reveals that zebrafish 1fng is a maternal factor existing in matured eggs, suggesting that fish somitogcnesis may be influenced by maternal factors.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We cloned and characterized a 3.3-kb fragment containing the 5'-regulatory region of the human myostatin gene. The promoter sequence contains putative muscle growth response elements for glucocorticoid, androgen, thyroid hormone, myogenic differentiation factor 1, myocyte enhancer factor 2, peroxisome proliferator-activated receptor, and nuclear factor-kappaB. To identify sites important for myostatin's gene transcription and regulation, eight deletion constructs were placed in C(2)C(12) and L6 skeletal muscle cells. Transcriptional activity of the constructs was found to be significantly higher in myotubes compared with that of myoblasts. To investigate whether glucocorticoids regulate myostatin gene expression, we incubated both cell lines with dexamethasone. On both occasions, dexamethasone dose dependently increased both the promoter's transcriptional activity and the endogenous myostatin expression. The effects of dexamethasone were blocked when the cells were coincubated with the glucocorticoid receptor antagonist RU-486. These findings suggest that glucocorticoids upregulate myostatin expression by inducing gene transcription, possibly through a glucocorticoid receptor-mediated pathway. We speculate that glucocorticoid-associated muscle atrophy might be due in part to the upregulation of myostatin expression.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

BACKGROUND: Deposition of beta-amyloid in the brains of patients with Alzheimer's disease is thought to precede a chain of events that leads to an inflammatory response by the brain. We postulated that genetic variation in the regulatory region of the gene for the proinflammatory cytokine tumour necrosis factor alpha (TNF-alpha) leads to increased risk of Alzheimer's disease and vascular dementia. METHODS: A polymorphism in the regulatory region of the TNF-alpha gene was analysed in a case-control study. The polymorphism (C-850T) was typed in 242 patients with sporadic Alzheimer's disease, 81 patients with vascular dementia, 61 stroke patients without dementia, and 235 normal controls. These groups of individuals were also genotyped for the apolipoprotein E polymorphism, and the vascular dementia and stroke groups were typed at the HLA-DR locus. FINDINGS: The distribution of TNF-alpha genotypes in the vascular dementia group differed significantly from that in the stroke and normal control groups, giving an odds ratio of 2.51 (95% CI 1.49-4.21) for the development of vascular dementia for individuals with a CT or TT genotype. Logistic regression analysis indicated that the possession of the T allele significantly increased the risk of Alzheimer's disease associated with carriage of the apolipoprotein E epsilon4 allele (odds ratio 2.73 [1.68-4.44] for those with apolipoprotein E epsilon4 but no TNF-alpha T, vs 4.62 [2.38-8.96] for those with apolipoprotein E epsilon4 and TNF-alpha T; p=0.03). INTERPRETATION: Possession of the TNF-alpha T allele significantly increases the risk of vascular dementia, and increases the risk of Alzheimer's disease associated with apolipoprotein E. Although further research is needed, these findings suggest a potential role for anti-inflammatory therapy in vascular dementia and Alzheimer's disease, and perhaps especially in patients who have had a stroke.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The 5` cis-regulatory region of the CCR5 gene exhibits a strong signature of balancing selection in several human populations. Here we analyze the polymorphism of this region in Amerindians from Amazonia, who have a complex demographic history, including recent bottlenecks that are known to reduce genetic variability. Amerindians show high nucleotide diversity (pi = 0.27%) and significantly positive Tajima`s D, and carry haplotypes associated with weak and strong gene expression. To evaluate whether these signatures of balancing selection could be explained by demography, we perform neutrality tests based on empiric and simulated data. The observed Tajima`s D was higher than that of other world populations: higher than that found for 18 noncoding regions of South Amerindians, and higher than 99.6% of simulated genealogies, which assume nonequilibrium conditions. Moreover, comparing Amerindians and Asians, the Fst for CCR5 cis-regulatory region was unusually low, in relation to neutral markers. These findings indicate that, despite their complex demographic history, South Amerindians carry a detectable signature of selection on the CCR5 cis-regulatory region. (C) 2010 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Growth hormone (GH), insulin-like growth factors 1 and 2 (IGF1 and IGF2) and their associated binding proteins and transmembrane receptors (GHR, IGF1R and IGF2R) play an important role in the physiology of mammalian growth. The objectives of the present study were to estimate the allele and genotype frequencies of microsatellite markers located in the 5'-regulatory region of the IGF1 and GHR genes in beef cattle belonging to different genetic groups and to determine effects of these markers on growth and carcass traits in these animals under an intensive production system. For this purpose, genotyping was performed on 384 bulls including 79 Nellore, 30 Canchim (5/8 Charolais + 3/8 Zebu) and 275 crossbred animals originating from crosses of Simmental (1/2 Simmental, n = 30) and Angus (1/2 Angus, n = 245) sires with Nellore females. The effects of substituting L allele for S allele of GHR microsatellite across Nellore, Canchim and 1/2 Angus were significant for weight gain and body weight (P < 0.05). The IGF1 microsatellite allele substitutions of 229 for 225 within Nellore group and of 225 for 229 within 1/2 Angus were not significant for any of the traits.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Induction of cell-autonomous apoptosis following oncogene-induced overproliferation is a major tumor-suppressive mechanism in vertebrates. However, the detailed mechanism mediating this process remains enigmatic. In this study, we demonstrate that dMyc-induced cell-autonomous apoptosis in the fruit fly Drosophila melanogaster relies on an intergenic sequence termed the IRER (irradiation-responsive enhancer region). The IRER mediates the expression of surrounding proapoptotic genes, and we use an in vivo reporter of the IRER chromatin state to gather evidence that epigenetic control of DNA accessibility within the IRER is an important determinant of the strength of this response to excess dMyc. In a previous work, we showed that the IRER also mediates P53-dependent induction of proapoptotic genes following DNA damage, and the chromatin conformation within IRER is regulated by polycomb group-mediated histone modifications. dMyc-induced apoptosis and the P53-mediated DNA damage response thus overlap in a requirement for the IRER. The epigenetic mechanisms controlling IRER accessibility appear to set thresholds for the P53- and dMyc-induced expression of apoptotic genes in vivo and may have a profound impact on cellular sensitivity to oncogene-induced stress.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A cellular protein, previously described as p35/38, binds to the complementary (−)-strand of the leader RNA and intergenic (IG) sequence of mouse hepatitis virus (MHV) RNA. The extent of the binding of this protein to IG sites correlates with the efficiency of the subgenomic mRNA transcription from that IG site, suggesting that it is a requisite transcription factor. We have purified this protein and determined by partial peptide sequencing that it is heterogeneous nuclear ribonucleoprotein (hnRNP) A1, an abundant, primarily nuclear protein. hnRNP A1 shuttles between the nucleus and cytoplasm and plays a role in the regulation of alternative RNA splicing. The MHV(−)-strand leader and IG sequences conform to the consensus binding motifs of hnRNP A1. Recombinant hnRNP A1 bound to these two RNA regions in vitro in a sequence-specific manner. During MHV infection, hnRNP A1 relocalizes from the nucleus to the cytoplasm, where viral replication occurs. These data suggest that hnRNP A1 is a cellular factor that regulates the RNA-dependent RNA transcription of the virus.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The DNA binding activity of p53 is crucial for its tumor suppressor function and is subject to tight regulation. Previous studies revealed that the inhibitory function of the p53 C terminus is implicated in the latent, low affinity sequence-specific DNA binding activity of p53 in the uninduced state. Sequence-specific DNA binding of p53 has been shown to be activated by several posttranslational modifications and interacting proteins that target predominantly the C terminus. Moreover, several authors have shown that synthetic peptides corresponding to p53 C-terminal sequences activate p53 sequence-specific DNA binding. In an effort to identify the interaction site of p53 with these activating peptides we assessed complex formation between p53 deletion constructs and C-terminal activating peptides by peptide affinity precipitation. This study revealed that two distal regions of the p53 molecule contribute synergistically to the interaction with activating C-terminal peptides: amino acids 80–93 and 364–393. The C-terminal residues 364–393 are already well characterized as having negative regulatory function. DNA binding analyses with these deletion constructs reveal a comparable negative regulatory activity for residues 80–93, defining this region as a previously unidentified negative regulatory domain of p53. Furthermore, synthetic peptides spanning this newly identified proline-rich negative regulatory region (residues 80–93) are able to activate p53 sequence-specific DNA binding in vitro. We suggest that both negative regulatory regions, residues 80–93 and 364–393, contribute cooperatively to the maintenance of the latent, low-affinity DNA binding conformation of p53.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Human platelet-derived growth factor (PDGF) is composed of two polypeptide chains, PDGF-1 and PDGF-2,the human homolog of the v-sis oncogene. Deregulation of PDGF-2 expression can confer a growth advantage to cells possessing the cognate receptor and, thus, may contribute to the malignant phenotype. We investigated the regulation of PDGF-2 mRNA expression during megakaryocytic differentiation of K562 cells. Induction by 12-O-tetradecanoylphorbol-13-acetate (TPA) led to a greater than 200-fold increase in PDGF-2 transcript levels in these cells. Induction was dependent on protein synthesis and was not enhanced by cycloheximide exposure.In our initial investigation of the PDGF-2 promoter, a minimal promoter region, which included sequences extending only 42 base pairs upstream of the TATA signal, was found to be as efficient as 4 kilobase pairs upstream of the TATA signal in driving expression of a reporter gene in uninduced K562 cells. We also functionally identified different regulatory sequence elements of the PDGF-2 promoter in TPA-induced K562 cells. One region acted as a transcriptional silencer, while another region was necessary for maximal activity of the promoter in megakaryoblasts. This region was shown to bind nuclear factors and was the target for trans-activation in normal and tumor cells. In one tumor cell line, which expressed high PDGF-2 mRNA levels, the presence of the positive regulatory region resulted in a 30-fold increase in promoter activity. However, the ability of the minimal PDGF-2 promoter to drive reporter gene expression in uninduced K562 cells and normal fibroblasts, which contained no detectable PDGF-2 transcripts, implies the existence of other negative control mechanisms beyond the regulation of promoter activity.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The majority of Escherichia coli strains isolated from urinary tract infections have the potential to express multiple fimbriae. Two of the most common fimbrial adhesins are type 1 fimbriae and pyelonephritis-associated pili (Pap). Previous research has shown that induced, plasmid-based expression of a Pap regulator, papB, and its close homologues can prevent inversion of the fim switch controlling the expression of type 1 fimbriae. The aim of the present study was to determine if this cross-regulation occurs when PapB is expressed from its native promoter in the chromosome of E. coli K-12 and clinical isolates. The regulation was examined in three ways: (1) mutated alleles of the pap regulatory region, including papB and papI, that maintain the pap promoter in either the off or the on phase were exchanged into the chromosome of both E. coli K-12 and the clinical isolate E. coli CFT073, and the effect on type 1 fimbrial expression was measured; (2) type 1 fimbrial expression was determined using a novel fimS : : gfp+ reporter system in mutants of the clinical isolate E. coli 536 in which combinations of complete fimbrial clusters had been deleted; (3) type 1 fimbrial expression was determined in a range of clinical isolates and compared with both the number of P clusters and their expression. All three approaches demonstrated that P expression represses type 1 fimbrial expression. Using a number of novel genetic approaches, this work extends the initial finding that PapB inhibits FimB recombination to the impact of this regulation in clinical isolates.