911 resultados para Random PCR
Resumo:
Monoclonal antibody (MAb) 263 is a widely used monoclonal antibody that recognizes the extracellular domain (ECD) of the GH receptor. It has been shown to act as a GH agonist both in vitro and in vivo, and we report here that it must be divalent to exert its effect on the full-length receptor. To understand the mechanism of its agonist action, we have determined the precise epitope for this antibody using a novel random PCR mutagenesis approach together with expression screening in yeast. A library of 5200 clones of rabbit GH receptor ECD mutants were screened both with MAb 263 and with an anticarboxy-tag antibody to verify complete ECD expression. Sequencing for clones that expressed complete ECD but were not MAb 263 positive identified 20 epitope residues distributed in a discontinuous manner throughout the ECD. The major part of the epitope, as revealed after mapping onto the crystal structure model of the ECD molecule, was located on the side and upper portion of domain 1, particularly within the D - E strand disulfide loop 79 - 96. Molecular dynamics docking of an antibody of the same isotype as MAb 263 was used to dock the bivalent antibody to the 1528-Angstrom(2) epitope and to visualize the likely consequences of MAb binding. The minimized model enables the antibody to grasp two receptors in a pincer-like movement from opposite sides, facilitating alignment of the receptor dimerization domains in a manner similar to, but not identical with, GH.
Resumo:
RAPD markers have been used for the analysis of genetic differentiation of Aedes aegypti, because they allow the study of genetic relationships among populations. The aim of this study was to identify populations in different geographic regions of the São Paulo State in order to understand the infestation pattern of A. aegypti. The dendrogram constructed with the combined data set of the RAPD patterns showed that the mosquitoes were segregated into two major clusters. Mosquitoes from the Western region of the São Paulo State constituted one cluster and the other was composed of mosquitoes from a laboratory strain and from a coastal city, where the largest Latin American port is located. These data are in agreement with the report on the infestation in the São Paulo State. The genetic proximity was greater between mosquitoes whose geographic origin was closer. However, mosquitoes from the coastal city were genetically closer to laboratory-reared mosquitoes than to field-collected mosquitoes from the São Paulo State. The origin of the infestation in this place remains unclear, but certainly it is related to mosquitoes of origins different from those that infested the West and North region of the State in the 80's.
Resumo:
The phlebotomine sand fly Lutzomyia longipalpis has been incriminated as a vector of American visceral leishmaniasis, caused by Leishmania chagasi. However, some evidence has been accumulated suggesting that it may exist in nature not as a single but as a species complex. Our goal was to compare four laboratory reference populations of L. longipalpis from distinct geographic regions at the molecular level by RAPD-PCR. We screened genomic DNA for polymorphic sites by PCR amplification with decamer single primers of arbitrary nucleotide sequences. One primer distinguished one population (Marajó Island, Pará State, Brazil) from the other three (Lapinha Cave, Minas Gerais State, Brazil; Melgar, Tolima Department, Colombia and Liberia, Guanacaste Province, Costa Rica). The population-specific and the conserved RAPD-PCR amplified fragments were cloned and shown to differ only in number of internal repeats.
Resumo:
Susceptibility of snails to infection by certain trematodes and their suitability as hosts for continued development has been a bewildering problem in host-parasite relationships. The present work emphasizes our interest in snail genetics to determine what genes or gene products are specifically responsible for susceptibility of snails to infection. High molecular weight DNA was extracted from both susceptible and non-susceptible snails within the same species Biomphalaria tenagophila. RAPD was undertaken to distinguish between the two types of snails. Random primers (10 mers) were used to amplify the extracted DNA by the polymerase chain reaction (PCR) followed by polyacrylamide gel electrophoresis (PAGE) and silver staining. The results suggest that RAPD represents an efficient means of genome comparison, since many molecular markers were detected as genetic variations between susceptible and non-susceptible snails.
Resumo:
The Triatominae (Hemiptera:Reduviidae) contains the principal and potential Chagas disease vectors present in Mexico, Central America and South America. Triatoma flavida and T. bruneri are Cuban species. These species are closely related according to morphology and were considered synonyms until 1981, when they were separated on the grounds of external characters of the body and the morphology of male genitalia. The present study seeks to analyze genetic polymorphism of T. flavida and T. bruneri populations using RAPD techniques, and to assess the genetic relationship between these species. Ten random primers were used to evaluate the genetic variability among species using RAPD-PCR. The genetic flow among them was calculated. The dendrogram based on calculated Jaccard distances showed two clearly distinguishable clusters which coincided with the studied species. Within each species, moderate genetic differentiation (Fst 0.05-0.15) and migration rates (N > 1) were found among populations, that reveal gene flow and genetic homogeneity. Between species, the Fst value showed a high genetic differentiation and the migration rate was insufficient to maintain genetic homogeneity, and confirmed the absence of gene flow between them. Our results confirm the genetic variability among T. flavida and T. bruneri species.
Resumo:
Thirteen strains of the genus Candida were isolated from catheter, urine and surgical wounds from individual patients of the Santa Casa de Misericórdia, Belo Horizonte, MG, Brazil. Ten strains were characterized as Candida albicans, two as Candida glabrata, and one as Candida parapsilosis. Isolates were evaluated for molecular relatedness by random amplified polymorphic DNA technique using 15 primers. The analysis of the genomic DNA obtained revealed a low intraspecific polymorphism and did not allow for the differentiation between strains of the same species obtained from distinct clinical sources (catheter, urine and surgical wounds). The RAPD profiles generated were able to differentiate among the species of Candida albicans, Candida parapsilosis and Candida glabrata strains isolated in this study.
Resumo:
Species-specific Random Amplified Polymorphic DNA-Polymerase chain Reaction (RAPD-PCR) markers were used to identify four species related to Anopheles (Nyssorhynchus) albitarsis Lynch-Arribàlzaga from 12 sites in Brazil and 4 in Venezuela. In a previous study (Wilkerson et al. 1995), which included sites in Paraguay and Argentina, these four species were designated "A", "B", "C" and "D". It was hypothesized that species A is An. (Nys.) albitarsis, species B is undescribed, species C is An. (Nys) marajoara Galvão and Damasceno and species D is An. (Nys.) deaneorum Rosa-Freitas. Species D, previously characterized by RAPD-PCR from a small sample from northern Argentina and southern Brazil, is reported here from the type locality of An. (Nys.) deaneorum, Guajará-Mirim, state of Rondônia, Brazil. Species C and D were found by RAPD-PCR to be sympatric at Costa Marques, state of Rondônia, Brazil. Species A and C have yet to be encountered at the same locality. The RAPD markers for species C were found to be conserved over 4,620 km; from Iguape, state of São Paulo, Brazil to rio Socuavo, state of Zulia, Venezuela. RAPD-PCR was determined to be an effective means for the identification of unknown species within this species complex.
Resumo:
Molecular studies of insect disease vectors are of paramount importance for understanding parasite-vector relationship. Advances in this area have led to important findings regarding changes in vectors' physiology upon blood feeding and parasite infection. Mechanisms for interfering with the vectorial capacity of insects responsible for the transmission of diseases such as malaria, Chagas disease and dengue fever are being devised with the ultimate goal of developing transgenic insects. A primary necessity for this goal is information on gene expression and control in the target insect. Our group is investigating molecular aspects of the interaction between Leishmania parasites and Lutzomyia sand flies. As an initial step in our studies we have used random sequencing of cDNA clones from two expression libraries made from head/thorax and abdomen of sugar fed L. longipalpis for the identification of expressed sequence tags (EST). We applied differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR to characterize differentially expressed mRNA from sugar and blood fed insects, and, in one case, from a L. (V.) braziliensis-infected L. longipalpis. We identified 37 cDNAs that have shown homology to known sequences from GeneBank. Of these, 32 cDNAs code for constitutive proteins such as zinc finger protein, glutamine synthetase, G binding protein, ubiquitin conjugating enzyme. Three are putative differentially expressed cDNAs from blood fed and Leishmania-infected midgut, a chitinase, a V-ATPase and a MAP kinase. Finally, two sequences are homologous to Drosophila melanogaster gene products recently discovered through the Drosophila genome initiative.
Resumo:
The aim of this work was to determine approaches that would improve the quality of ancient DNA (aDNA) present in coprolites to enhance the possibility of success in retrieving specific sequence targets. We worked with coprolites from South American archaeological sites in Brazil and Chile dating up to 7,000 years ago. Using established protocols for aDNA extraction we obtained samples showing high degradation as usually happens with this kind of material. The reconstructive polymerization pretreatment was essential to overcome the DNA degradation and the serial dilutions helped with to prevent polymerase chain reaction (PCR) inhibitors. Moreover, the random amplified polymorphic DNA-PCR has been shown to be a reliable technique for further experiments to recover specific aDNA sequences.
Resumo:
Chronic granulomatous disease (CGD) is an inherited disorder of the innate immune system characterized by a defective oxidative burst of phagocytes and subsequent impairment of their microbicidal activity. Mutations in one of the NADPH-oxidase components affect gene expression or function of this system, leading to the phenotype of CGD. Defects in gp91-phox lead to X-linked CGD, responsible for approximately 70% of CGD cases. Investigation of the highly heterogeneous genotype of CGD patients includes mutation analysis, Northern blot or Western blot assays according to the particular case. The aim of the present study was to use reverse transcription (RT)-PCR for the analysis of molecular defects responsible for X-linked CGD in eight Brazilian patients and to assess its potential for broader application to molecular screening in CGD. Total RNA was prepared from Epstein B virus-transformed B-lymphocytes and reverse transcribed using random hexamers. The resulting cDNA was PCR-amplified by specific and overlapping pairs of primers designed to amplify three regions of the gp91-phox gene: exons 1-5, 3-9, and 7-13. This strategy detected defective gp91-phox expression in seven patients. The RT-PCR results matched clinical history, biochemical data (nitroblue tetrazolium or superoxide release assay) and available mutation analysis in four cases. In three additional cases, RT-PCR results matched clinical history and biochemical data. In another case, RT-PCR was normal despite a clinical history compatible with CGD and defective respiratory burst. We conclude that this new application of RT-PCR analysis - a simple, economical and rapid method - was appropriate for screening molecular defects in 7 of 8 X-linked CGD patients.
Resumo:
Lophius gastrophysus has important commercial value in Brazil particularly for foreign trade. In this study, we described the optimization of Random Amplified Polymorphic DNA (RAPD) protocol for identification of L. gastrophysus. Different conditions (annealing temperatures, MgCl concentrations, DNA quantity) were tested to find reproducible and adequate profiles. Amplifications performed with primers A01, ² A02 and A03 generate the best RAPD profiles when the conditions were annealing temperature of 36ºC, 25 ng of DNA quantity and 2.5 mM MgCl2. Exact identification of the species and origin of marine products is necessary and RAPD could be used as an accurate, rapid tool to expose commercial fraud.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
A LightCycler(R) real-time PCR hybridization probe-based assay that detects a conserved region of the 16S rRNA gene of pathogenic but not saprophytic Leptospira species was developed for the rapid detection of pathogenic leptospires directly from processed tissue samples. In addition, a differential PCR specific for saprophytic leptospires and a control PCR targeting the porcine beta-actin gene were developed. To assess the suitability of these PCR methods for diagnosis, a trial was performed on kidneys taken from adult pigs with evidence of leptospiral infection, primarily a history of reproductive disease and serological evidence of exposure to pathogenic leptospires (n = 180) and aborted pig foetuses (n = 24). Leptospire DNA was detected by the 'pathogenic' specific PCR in 25 tissues (14%) and the control beta-actin PCR was positive in all 204 samples confirming DNA was extracted from all samples. No leptospires were isolated from these samples by culture and no positives were detected with the 'saprophytic' PCR. In a subsidiary experiment, the 'pathogenic' PCR was used to analyse kidney samples from rodents (n = 7) collected as part of vermin control in a zoo, with show animals with high microagglutination titres to Leptospira species, and five were positive. Fifteen PCR amplicons from 1 mouse, 2 rat and 14 pig kidney samples, were selected at random from positive PCRs (n = 30) and sequenced. Sequence data indicated L. interrogans DNA in the pig and rat samples and L. inadai DNA, which is considered of intermediate pathogenicity, in the mouse sample. The only successful culture was from this mouse kidney and the isolate was confirmed to be L. inadai by classical serology. These data suggest this suite of PCRs is suitable for testing for the presence of pathogenic leptospires in pig herds where abortions and infertility occur and potentially in other animals such as rodents. Crown Copyright (C) 2007 Published by Elsevier Ltd. All rights reserved.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.