989 resultados para REGULATORY REGION
Resumo:
Association studies between ADIPOR1 genetic variants and predisposition to type 2 diabetes (DM2) have provided contradictory results. We determined if two single nucleotide polymorphisms (SNP c.-8503G>A and SNP c.10225C>G) in regulatory regions of ADIPOR1 in 567 Brazilian individuals of European (EA; N = 443) or African (AfA; N = 124) ancestry from rural (quilombo remnants; N = 439) and urban (N = 567) areas. We detected a significant effect of ethnicity on the distribution of the allelic frequencies of both SNPs in these populations (EA: -8503A = 0.27; AfA: -8503A = 0.16; P = 0.001 and EA: 10225G = 0.35; AfA: 10225G = 0.51; P < 0.001). Neither of the polymorphisms were associated with DM2 in the case-control study in EA (SNP c.-8503G>A: DM2 group -8503A = 0.26; control group -8503A = 0.30; P = 0.14/SNP 10225C>G: DM2 group 10225G = 0.37; control group 10225G = 0.32; P = 0.40) and AfA populations (SNP c.-8503G>A: DM2 group -8503A = 0.16; control group -8503A = 0.15; P = 0.34/SNP 10225C>G: DM2 group 10225G = 0.51; control group 10225G = 0.52; P = 0.50). Similarly, none of the polymorphisms were associated with metabolic/anthropometric risk factors for DM2 in any of the three populations, except for HDL cholesterol, which was significantly higher in AfA heterozygotes (GC = 53.75 ± 17.26 mg/dL) than in homozygotes. We conclude that ADIPOR1 polymorphisms are unlikely to be major risk factors for DM2 or for metabolic/anthropometric measurements that represent risk factors for DM2 in populations of European and African ancestries.
Resumo:
The study of transcriptional regulation often needs the integration of diverse yet independent data. In the present work, sequence conservation, predic-tion of transcription factor binding sites (TFBS) and gene expression analysis have been applied to the detection of putative transcription factor (TF) modules in the regulatory region of the FGFR3 oncogene. Several TFs with conserved binding sites in the FGFR3 regulatory region have shown high positive or negative corre-lation with FGFR3 expression both in urothelial carcinoma and in benign nevi. By means of conserved TF cluster analysis, two different TF modules have been iden-tified in the promoter and first intron of FGFR3 gene. These modules contain acti-vating AP2, E2F, E47 and SP1 binding sites plus motifs for EGR with possible repressor function.
Resumo:
Association studies between ADIPOR1 genetic variants and predisposition to type 2 diabetes (DM2) have provided contradictory results. We determined if two single nucleotide polymorphisms (SNP c.-8503G>A and SNP c.10225C>G) in regulatory regions of ADIPOR1 in 567 Brazilian individuals of European (EA; N = 443) or African (AfA; N = 124) ancestry from rural (quilombo remnants; N = 439) and urban (N = 567) areas. We detected a significant effect of ethnicity on the distribution of the allelic frequencies of both SNPs in these populations (EA: -8503A = 0.27; AfA: -8503A = 0.16; P = 0.001 and EA: 10225G = 0.35; AfA: 10225G = 0.51; P < 0.001). Neither of the polymorphisms were associated with DM2 in the case-control study in EA (SNP c.-8503G>A: DM2 group -8503A = 0.26; control group -8503A = 0.30; P = 0.14/SNP 10225C>G: DM2 group 10225G = 0.37; control group 10225G = 0.32; P = 0.40) and AfA populations (SNP c.-8503G>A: DM2 group -8503A = 0.16; control group -8503A = 0.15; P = 0.34/SNP 10225C>G: DM2 group 10225G = 0.51; control group 10225G = 0.52; P = 0.50). Similarly, none of the polymorphisms were associated with metabolic/anthropometric risk factors for DM2 in any of the three populations, except for HDL cholesterol, which was significantly higher in AfA heterozygotes (GC = 53.75 ± 17.26 mg/dL) than in homozygotes. We conclude that ADIPOR1 polymorphisms are unlikely to be major risk factors for DM2 or for metabolic/anthropometric measurements that represent risk factors for DM2 in populations of European and African ancestries.
Resumo:
The 5` cis-regulatory region of the CCR5 gene exhibits a strong signature of balancing selection in several human populations. Here we analyze the polymorphism of this region in Amerindians from Amazonia, who have a complex demographic history, including recent bottlenecks that are known to reduce genetic variability. Amerindians show high nucleotide diversity (pi = 0.27%) and significantly positive Tajima`s D, and carry haplotypes associated with weak and strong gene expression. To evaluate whether these signatures of balancing selection could be explained by demography, we perform neutrality tests based on empiric and simulated data. The observed Tajima`s D was higher than that of other world populations: higher than that found for 18 noncoding regions of South Amerindians, and higher than 99.6% of simulated genealogies, which assume nonequilibrium conditions. Moreover, comparing Amerindians and Asians, the Fst for CCR5 cis-regulatory region was unusually low, in relation to neutral markers. These findings indicate that, despite their complex demographic history, South Amerindians carry a detectable signature of selection on the CCR5 cis-regulatory region. (C) 2010 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
Resumo:
Growth hormone (GH), insulin-like growth factors 1 and 2 (IGF1 and IGF2) and their associated binding proteins and transmembrane receptors (GHR, IGF1R and IGF2R) play an important role in the physiology of mammalian growth. The objectives of the present study were to estimate the allele and genotype frequencies of microsatellite markers located in the 5'-regulatory region of the IGF1 and GHR genes in beef cattle belonging to different genetic groups and to determine effects of these markers on growth and carcass traits in these animals under an intensive production system. For this purpose, genotyping was performed on 384 bulls including 79 Nellore, 30 Canchim (5/8 Charolais + 3/8 Zebu) and 275 crossbred animals originating from crosses of Simmental (1/2 Simmental, n = 30) and Angus (1/2 Angus, n = 245) sires with Nellore females. The effects of substituting L allele for S allele of GHR microsatellite across Nellore, Canchim and 1/2 Angus were significant for weight gain and body weight (P < 0.05). The IGF1 microsatellite allele substitutions of 229 for 225 within Nellore group and of 225 for 229 within 1/2 Angus were not significant for any of the traits.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Induction of cell-autonomous apoptosis following oncogene-induced overproliferation is a major tumor-suppressive mechanism in vertebrates. However, the detailed mechanism mediating this process remains enigmatic. In this study, we demonstrate that dMyc-induced cell-autonomous apoptosis in the fruit fly Drosophila melanogaster relies on an intergenic sequence termed the IRER (irradiation-responsive enhancer region). The IRER mediates the expression of surrounding proapoptotic genes, and we use an in vivo reporter of the IRER chromatin state to gather evidence that epigenetic control of DNA accessibility within the IRER is an important determinant of the strength of this response to excess dMyc. In a previous work, we showed that the IRER also mediates P53-dependent induction of proapoptotic genes following DNA damage, and the chromatin conformation within IRER is regulated by polycomb group-mediated histone modifications. dMyc-induced apoptosis and the P53-mediated DNA damage response thus overlap in a requirement for the IRER. The epigenetic mechanisms controlling IRER accessibility appear to set thresholds for the P53- and dMyc-induced expression of apoptotic genes in vivo and may have a profound impact on cellular sensitivity to oncogene-induced stress.
Resumo:
Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^
Resumo:
A cellular protein, previously described as p35/38, binds to the complementary (−)-strand of the leader RNA and intergenic (IG) sequence of mouse hepatitis virus (MHV) RNA. The extent of the binding of this protein to IG sites correlates with the efficiency of the subgenomic mRNA transcription from that IG site, suggesting that it is a requisite transcription factor. We have purified this protein and determined by partial peptide sequencing that it is heterogeneous nuclear ribonucleoprotein (hnRNP) A1, an abundant, primarily nuclear protein. hnRNP A1 shuttles between the nucleus and cytoplasm and plays a role in the regulation of alternative RNA splicing. The MHV(−)-strand leader and IG sequences conform to the consensus binding motifs of hnRNP A1. Recombinant hnRNP A1 bound to these two RNA regions in vitro in a sequence-specific manner. During MHV infection, hnRNP A1 relocalizes from the nucleus to the cytoplasm, where viral replication occurs. These data suggest that hnRNP A1 is a cellular factor that regulates the RNA-dependent RNA transcription of the virus.
Resumo:
The DNA binding activity of p53 is crucial for its tumor suppressor function and is subject to tight regulation. Previous studies revealed that the inhibitory function of the p53 C terminus is implicated in the latent, low affinity sequence-specific DNA binding activity of p53 in the uninduced state. Sequence-specific DNA binding of p53 has been shown to be activated by several posttranslational modifications and interacting proteins that target predominantly the C terminus. Moreover, several authors have shown that synthetic peptides corresponding to p53 C-terminal sequences activate p53 sequence-specific DNA binding. In an effort to identify the interaction site of p53 with these activating peptides we assessed complex formation between p53 deletion constructs and C-terminal activating peptides by peptide affinity precipitation. This study revealed that two distal regions of the p53 molecule contribute synergistically to the interaction with activating C-terminal peptides: amino acids 80–93 and 364–393. The C-terminal residues 364–393 are already well characterized as having negative regulatory function. DNA binding analyses with these deletion constructs reveal a comparable negative regulatory activity for residues 80–93, defining this region as a previously unidentified negative regulatory domain of p53. Furthermore, synthetic peptides spanning this newly identified proline-rich negative regulatory region (residues 80–93) are able to activate p53 sequence-specific DNA binding in vitro. We suggest that both negative regulatory regions, residues 80–93 and 364–393, contribute cooperatively to the maintenance of the latent, low-affinity DNA binding conformation of p53.
Resumo:
Acetylcholine, one of the main neurotransmitters in the nervous system, is synthesized by the enzyme choline acetyltransferase (ChAT; acetyl-CoA:choline O-acetyltransferase, EC 2.3.1.6). The molecular mechanisms controlling the establishment, maintenance, and plasticity of the cholinergic phenotype in vivo are largely unknown. A previous report showed that a 3800-bp, but not a 1450-bp, 5' flanking segment from the rat ChAT gene promoter directed cell type-specific expression of a reporter gene in cholinergic cells in vitro. Now we have characterized a distal regulatory region of the ChAT gene that confers cholinergic specificity on a heterologous downstream promoter in a cholinergic cell line and in transgenic mice. A 2342-bp segment from the 5' flanking region of the ChAT gene behaved as an enhancer in cholinergic cells but as a repressor in noncholinergic cells in an orientation-independent manner. Combined with a heterologous basal promoter, this fragment targeted transgene expression to several cholinergic regions of the central nervous system of transgenic mice, including basal forebrain, cortex, pons, and spinal cord. In eight independent transgenic lines, the pattern of transgene expression paralleled qualitatively and quantitatively that displayed by endogenous ChAT mRNA in various regions of the rat central nervous system. In the lumbar enlargement of the spinal cord, 85-90% of the transgene expression was targeted to the ventral part of the cord, where cholinergic alpha-motor neurons are located. Transgene expression in the spinal cord was developmentally regulated and responded to nerve injury in a similar way as the endogenous ChAT gene, indicating that the 2342-bp regulatory sequence contains elements controlling the plasticity of the cholinergic phenotype in developing and injured neurons.
Resumo:
Objectives: To investigate the presence of mutations in the pncA gene in 31 pyrazinamide-resistant Mycobacterium tuberculosis and 5 susceptible strains. MICs and pyrazinamidase (PZase) activity were also determined.Methods: All 36 M. tuberculosis clinical isolates were genotyped by mycobacterial interspersed repetitive units (MIRUs) and most were also typed by spoligotyping. The MIC value necessary to inhibit 99% of the resistant mycobacterial isolates was determined by microplate Alamar Blue assay (MABA) and by Lowenstein-Jensen assay (LJA). The PZase activity was measured by pyrazinamide deamination to pyrazinoic acid and ammonia, and the entire pncA sequence including the 410 by upstream from the start codon was determined by DNA sequencing of purified PCR products.Results: of the 31 isolates resistant to pyrazinamide, 26 (83.9%) showed at least one mutation in the pncA gene or in its putative regulatory region: Among the 22 different mutations detected in the pncA gene and in its regulatory region, 9 (40.9%) mutations (consisting of six substitutions, two insertions and one deletion) have not been described in previous studies. Three pyrazinamide-resistant isolates, confirmed by MIC varying from 800 to 1600 mg/L, carried the wild-type pncA sequence and retained PZase activity.Conclusions: These results contribute to the knowledge of the molecular mechanism of pyrazinamide resistance in Brazil and also expand the profile of pncA mutations worldwide. The MABA was successfully used to determine the MICs of pyrazinamide.
Resumo:
Background and Objectives. Thrombin activatable fibrinolysis inhibitor (TAFI) plays an important role in hemostasis, functioning as a potent fibrinolysis inhibitor. TAFI gene variations may contribute to plasma TAFI levels and thrombotic risk.Design and Methods. We sequenced a 2083-bp region of the 5 ' -regulatory region of the TAFI gene in 127 healthy subjects searching for variations, and correlated identified polymorphisms with plasma TAFI levels. TAFI polymorphisms were examined as risk factors for venous thrombosis by determining their prevalence in 388 patients with deep venous thrombosis (DVT) and in 388 controls.Results. Seven novel polymorphisms were identified: -152 A/G, -438 A/G, -530 C/T, -1053 T/C, -1102 T/G, -1690 G/A, and -1925 T/C. -152 A/G, -530 C/T and -1925 T/C were found to be in strong linkage disequilibrium, as were the -438 A/G, -1053 T/C, -1102 T/G and -1690 G/A, Plasma TAFI levels were higher in -43866/-1053CC/-1102GG/-1690AA homozygotes than In -438AG/-1053TC/-1102TG/-1690GA heterozygotes, and -438AA/-1053TT/-1102TT/-1690GG homozygotes had the lowest TAFI levels (p=0.0003). TAFI concentrations in -152AA/-530CC/-1925TT homozygotes were somewhat higher but not significantly different from levels observed for -152AG/-530CT/-1925TC heterozygotes, Taken in combination, -438AG/-1053TC/-1102TG/-1690GA and -438AA/-1053TT/-1102TT/-1690GG yielded an OR for DVT of 0.8 (95%CI: 0.6-1). in subjects aged < 35 years the OR was 0.7 (95%CI: 0.5-1.1), the OR for -152AG/-530CT/-1925TC was 1 (95%CI: 0.5-2.2) in the whole group of patients and controls, whereas in subjects aged <35 years the OR was 0.1 (95%CI: 0.02-0.9).Interpretation and Conclusions. Polymorphisms in the TAFI promoter determine plasma antigen levels and may influence the risk of venous thrombophilia. <(c)>2001, Ferrata Storti Foundation.
Resumo:
Fetal hemoglobin (Hb F), formed by two alpha globin chains (α) and two gamma chains (γ) (α2 γ2), has reduced expression in adults, ranging from 0 to 1% of total hemoglobin. Increased levels of Hb F are due to mutations in the β-globin family, which cause hereditary persistence of fetal hemoglobin (HPFH) and delta-beta thalassemia (δβ-thalassemia).The control of the production takes place by the regulatory region and regions outside the β-globin family, among them 2q16, 6q23, 8q, and Xp22.2.The aims of this study were to determine the presence and frequency of two mutations for δβ-thalassemia, the XmnI polymorphism and β-globin haplotypes in healthy individuals with increased Hb F in the State of São Paulo. We analyzed 60 samples of peripheral blood of healthy adults, without complaints of anemia. The samples were separated into two groups according to Hb F level: group I - 34 samples with Hb F ranging from 2 to 15% and group II - 26 samples with Hb F over 15%. In relation to the polymorphisms examined, we found three heterozygous individuals (5%) for Spanish δβ-thalassemia, belonging to group I, whose Hb F levels were within the normal range.The Sicilian δβ-thalassemia mutation was not found, indicating the need to study other polymorphisms related to the increase of Hb F in adult life.The frequency of XmnI polymorphism was 33.3% and the mean Hb F levels were 15.48 ± 11.69%.The frequency observed in our study for this polymorphic site is higher than that found in the literature for healthy subjects.This polymorphism was more prevalent in individuals with Hb F levels below 15%. For four samples positive for this polymorphism, the Hb F levels were explained by the presence of HPFH and Spanish δβ-thalassemia mutations, so that the presence of the XmnI polymorphic site was not a determinant in the overexpression of γ-globin genes. Regarding β-globin haplotypes, 18 alleles and 27 distinct genotypic patterns were found.The pattern Atp1/Atp2 was the mostfrequent genotype (13.72%).Of the 18 alleles, 13 showed atypical patterns.The results show that the haplotype V was the most frequent (27.45%), followed by atypical Atp2 (13.72%) and Atp1 (11.76%), and that there was a higher correlation with the presence of HPFH and XmnI polymorphism.The high frequency of haplotype V in our samples and high frequency of atypical haplotypes may reflect a high rate of miscegenation in this population, suggesting an ethnic characteristic for the Brazilian population, requiring the evaluation of population genetic markers to corroborate this hypothesis. © FUNPEC-RP.
Resumo:
The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the σ70 promoters P1, P4 and P5, to the σE promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like σ70 promoter and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal σ70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. A second proximal σ70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli.