985 resultados para Quantitative rt-pcr
Resumo:
Background: Considering the broad variation in the expression of housekeeping genes among tissues and experimental situations, studies using quantitative RT-PCR require strict definition of adequate endogenous controls. For glioblastoma, the most common type of tumor in the central nervous system, there was no previous report regarding this issue. Results: Here we show that amongst seven frequently used housekeeping genes TBP and HPRT1 are adequate references for glioblastoma gene expression analysis. Evaluation of the expression levels of 12 target genes utilizing different endogenous controls revealed that the normalization method applied might introduce errors in the estimation of relative quantities. Genes presenting expression levels which do not significantly differ between tumor and normal tissues can be considered either increased or decreased if unsuitable reference genes are applied. Most importantly, genes showing significant differences in expression levels between tumor and normal tissues can be missed. We also demonstrated that the Holliday Junction Recognizing Protein, a novel DNA repair protein over expressed in lung cancer, is extremely over-expressed in glioblastoma, with a median change of about 134 fold. Conclusion: Altogether, our data show the relevance of previous validation of candidate control genes for each experimental model and indicate TBP plus HPRT1 as suitable references for studies on glioblastoma gene expression.
Resumo:
Hypertension and congenital aortic valve malformations are frequent causes of ascending aortic aneurysms. The molecular mechanisms of aneurysm formation under these circumstances are not well understood. Reference genes for gene activity studies in aortic tissue that are not influenced by aortic valve morphology and its hemodynamic consequences, aortic dilatation, hypertension, or antihypertensive medication are not available so far. This study determines genes in ascending aortic tissue that are independent of these parameters. Tissue specimens from dilated and undilated ascending aortas were obtained from 60 patients (age ≤70 years) with different morphologies of the aortic valve (tricuspid undilated n = 24, dilated n = 11; bicuspid undilated n = 6, dilated n = 15; unicuspid dilated n = 4). Of the studied individuals, 36 had hypertension, and 31 received ACE inhibitors or AT1 receptor antagonists. The specimens were obtained intraoperatively from the wall of the ascending aorta. We analyzed the expression levels of 32 candidate reference genes by quantitative RT-PCR (RT-qPCR). Differential expression levels were assessed by parametric statistics. The expression analysis of these 32 genes by RT-qPCR showed that EIF2B1, ELF1, and PPIA remained constant in their expression levels in the different specimen groups, thus being insensitive to aortic valve morphology, aortic dilatation, hypertension, and medication with ACE inhibitors or AT1 receptor antagonists. Unlike many other commonly used reference genes, the genes EIF2B1, ELF1, and PPIA are neither confounded by aortic comorbidities nor by antihypertensive medication and therefore are most suitable for gene expression analysis of ascending aortic tissue.
Resumo:
Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) is a standard assay in molecular medicine for gene expression analysis. Samples from incisional/needle biopsies, laser-microdissected tumor cells and other biologic sources, normally available in clinical cancer studies, generate very small amounts of RNA that are restrictive for expression analysis. As a consequence, an RNA amplification procedure is required to assess the gene expression levels of such sample types. The reproducibility and accuracy of relative gene expression data produced by sensitive methodology as qRT-PCR when cDNA converted from amplified (A) RNA is used as template has not yet been properly addressed. In this study, to properly evaluate this issue, we performed 1 round of linear RNA amplification in 2 breast cell lines (C5.2 and HB4a) and assessed the relative expression of 34 genes using cDNA converted from both nonamplified (NA) and A RNA. Relative gene expression was obtained from beta actin or glyceraldehyde 3-phosphate dehydrogenase normalized data using different dilutions of cDNA, wherein the variability and fold-change differences in the expression of the 2 methods were compared. Our data showed that 1 round of linear RNA amplification, even with suboptimal-quality RNA, is appropriate to generate reproducible and high-fidelity qRT-PCR relative expression data that have similar confidence levels as those from NA samples. The use of cDNA that is converted from both A and NA RNA in a single qRT-PCR experiment clearly creates bias in relative gene expression data.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Background: Current methodology of gene expression analysis limits the possibilities of comparison between cells/tissues of organs in which cell size and/or number changes as a consequence of the study (e.g. starvation). A method relating the abundance of specific mRNA copies per cell may allow direct comparison or different organs and/or changing physiological conditions. Methods: With a number of selected genes, we analysed the relationship of the number of bases and the fluorescence recorded at a present level using cDNA standards. A lineal relationship was found between the final number of bases and the length of the transcript. The constants of this equation and those of the relationship between fluorescence and number of bases in cDNA were determined and a general equation linking the length of the transcript and the initial number of copies of mRNA was deduced for a given pre-established fluorescence setting. This allowed the calculation of the concentration of the corresponding mRNAs per g of tissue. The inclusion of tissue RNA and the DNA content per cell, allowed the calculation of the mRNA copies per cell. Results: The application of this procedure to six genes: Arbp, cyclophilin, ChREBP, T4 deiodinase 2, acetyl-CoA carboxylase 1 and IRS-1, in liver and retroperitoneal adipose tissue of food-restricted rats allowed precise measures of their changes irrespective of the shrinking of the tissue, the loss of cells or changes in cell size, factors that deeply complicate the comparison between changing tissue conditions. The percentage results obtained with the present methods were essentially the same obtained with the delta-delta procedure and with individual cDNA standard curve quantitative RT-PCR estimation. Conclusion: The method presented allows the comparison (i.e. as copies of mRNA per cell) between different genes and tissues, establishing the degree of abundance of the different molecular species tested.
Resumo:
The reverse transcription-polymerase chain reaction (RT-PCR) is the most sensitive method used to evaluate gene expression. Although many advances have been made since quantitative RT-PCR was first described, few reports deal with the mathematical bases of this technique. The aim of the present study was to develop and standardize a competitive PCR method using standard-curves to quantify transcripts of the myogenic regulatory factors MyoD, Myf-5, Myogenin and MRF4 in chicken embryos. Competitor cDNA molecules were constructed for each gene under study using deletion primers, which were designed to maintain the anchorage sites for the primers used to amplify target cDNAs. Standard-curves were prepared by co-amplification of different amounts of target cDNA with a constant amount of competitor. The content of specific mRNAs in embryo cDNAs was determined after PCR with a known amount of competitor and comparison to standard-curves. Transcripts of the housekeeping ß-actin gene were measured to normalize the results. As predicted by the model, most of the standard-curves showed a slope close to 1, while intercepts varied depending on the relative efficiency of competitor amplification. The sensitivity of the RT-PCR method permitted the detection of as few as 60 MyoD/Myf-5 molecules per reaction but approximately 600 molecules of MRF4/Myogenin mRNAS were necessary to produce a measurable signal. A coefficient of variation of 6 to 19% was estimated for the different genes analyzed (6 to 9 repetitions). The competitive RT-PCR assay described here is sensitive, precise and allows quantification of up to 9 transcripts from a single cDNA sample.
Resumo:
For obtaining accurate and reliable gene expression results it is essential that quantitative real-time RT-PCR (qRT-PCR) data are normalized with appropriate reference genes. The current exponential increase in postgenomic studies on the honey bee, Apis mellifera, makes the standardization of qRT-PCR results an important task for ongoing community efforts. For this aim we selected four candidate reference genes (actin, ribosomal protein 49, elongation factor 1-alpha, tbp-association factor) and used three software-based approaches (geNorm, BestKeeper and NormFinder) to evaluate the suitability of these genes as endogenous controls. Their expression was examined during honey bee development, in different tissues, and after juvenile hormone exposure. Furthermore, the importance of choosing an appropriate reference gene was investigated for two developmentally regulated target genes. The results led us to consider all four candidate genes as suitable genes for normalization in A. mellifera. However, each condition evaluated in this study revealed a specific set of genes as the most appropriated ones.
Resumo:
IFN-gamma mRNA expression was evaluated in nonstimulated peripheral blood mononuclear cells (PBMC) of HIV-infected and seronegative individuals using quantitative competitive and semiquantitative RT-PCR and the sensitivity of these methods was compared. A significant correlation was found between quantitative competitive and semiquantitative RT-PCR in samples of both HIV-seronegative (P = 0.004) and HIV-infected individuals (P = 0.0004). PBMC from HIV-infected individuals presented a remarkable increase of IFN-gamma mRNA expression, as determined by both types of RT-PCR methods. Semiquantitative RT-PCR even without an internal standard is also acceptable for measuring cytokine mRNA expression, but less reliable if small amounts are quantified. Moreover, we found that increased IFN-gammamRNA expression is independent of CD4+ cell count in AIDS-free HIV-infected patients.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Enterovirus 71 (EV71) is one of the main causative agents of hand, foot and mouth disease (HFMD) in young children. Infections caused by EV71 could lead to many complications, ranging from brainstem encephalitis to pulmonary oedema, resulting in high mortality. Thus, rapid detection of the virus is required to enable measures to be implemented in preventing widespread transmission. Based on primers and probes targeting at the VP1 region, a real-time reverse-transcriptase polymerase chain reaction (RT-PCR) hybridization probe assay was developed for specific detection of EV71 from clinical specimens. Quantitative analysis showed that the assay was able to detect as low as 5 EV71 viral copies and EV71 was detected from 46 of the 55 clinical specimens obtained from pediatric patients suffering from HFMD during the period from 2000 to 2003 in Singapore. This study showed that the single tube real-time RT-PCR assay developed in this study can be applied as a rapid and sensitive method for specific detection of EV71 directly from clinical specimens. (c) 2005 Elsevier Ltd. All rights reserved.
Resumo:
Bovine coronavirus (BCoV) is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae) and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested) with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256) in DEPC treated ultra-pure water, in fetal bovine serum (FBS) and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694). The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.