Reference genes for quantitative RT-PCR data in gastric tissues and cell lines

AIM: To evaluate the suitability of reference genes in gastric tissue samples and cell lines.METHODS: the suitability of genes ACTB, B2M, GAPDH, RPL29, and 18S rRNA was assessed in 21 matched pairs of neoplastic and adjacent nonneoplastic gastric tissues from patients with gastric adenocarcinoma, 27 normal gastric tissues from patients without cancer, and 4 cell lines using reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR). the ranking of the best single and combination of reference genes was determined by NormFinder, geNorm (TM), BestKeeper, and DataAssist (TM). in addition, GenEx software was used to determine the optimal number of reference genes. To validate the results, the mRNA expression of a target gene, DNMT1, was quantified using the different reference gene combinations suggested by the various software packages for normalization.RESULTS: ACTB was the best reference gene for all gastric tissues, cell lines and all gastric tissues plus cell lines. GAPDH + B2M or ACTB + B2M was the best combination of reference genes for all the gastric tissues. On the other hand, ACTB + B2M was the best combination for all the cell lines tested and was also the best combination for analyses involving all the gastric tissues plus cell lines. According to the GenEx software, 2 or 3 genes were the optimal number of references genes for all the gastric tissues. the relative quantification of DNMT1 showed similar patterns when normalized by each combination of reference genes. the level of expression of DNMT1 in neoplastic, adjacent non-neoplastic and normal gastric tissues did not differ when these samples were normalized using GAPDH + B2M (P = 0.32), ACTB + B2M (P = 0.61), or GAPDH + B2M + ACTB (P = 0.44).CONCLUSION: GAPDH + B2M or ACTB + B2M is the best combination of reference gene for all the gastric tissues, and ACTB + B2M is the best combination for the cell lines tested. (C) 2013 Baishideng Publishing Group Co., Limited. All rights reserved.

Evaluation of Quantitative RT-PCR Using Nonamplified and Amplified RNA

Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) is a standard assay in molecular medicine for gene expression analysis. Samples from incisional/needle biopsies, laser-microdissected tumor cells and other biologic sources, normally available in clinical cancer studies, generate very small amounts of RNA that are restrictive for expression analysis. As a consequence, an RNA amplification procedure is required to assess the gene expression levels of such sample types. The reproducibility and accuracy of relative gene expression data produced by sensitive methodology as qRT-PCR when cDNA converted from amplified (A) RNA is used as template has not yet been properly addressed. In this study, to properly evaluate this issue, we performed 1 round of linear RNA amplification in 2 breast cell lines (C5.2 and HB4a) and assessed the relative expression of 34 genes using cDNA converted from both nonamplified (NA) and A RNA. Relative gene expression was obtained from beta actin or glyceraldehyde 3-phosphate dehydrogenase normalized data using different dilutions of cDNA, wherein the variability and fold-change differences in the expression of the 2 methods were compared. Our data showed that 1 round of linear RNA amplification, even with suboptimal-quality RNA, is appropriate to generate reproducible and high-fidelity qRT-PCR relative expression data that have similar confidence levels as those from NA samples. The use of cDNA that is converted from both A and NA RNA in a single qRT-PCR experiment clearly creates bias in relative gene expression data.

Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Quantitative stem-loop RT-PCR for detection of microRNAs

Plant microRNAs (miRNAs) are a class of endogenous small RNAs that are essential for plant development and survival. They arise from larger precursor RNAs with a characteristic hairpin structure and regulate gene activity by targeting mRNA transcripts for cleavage or translational repression. Efficient and reliable detection and quantification of miRNA expression has become an essential step in understanding their specific roles. The expression levels of miRNAs can vary dramatically between samples and they often escape detection by conventional technologies such as cloning, northern hybridization and microarray analysis. The stem-loop RT-PCR method described here is designed to detect and quantify mature miRNAs in a fast, specific, accurate and reliable manner. First, a miRNA-specific stem-loop RT primer is hybridized to the miRNA and then reverse transcribed. Next, the RT product is amplified and monitored in real time using a miRNA-specific forward primer and the universal reverse primer. This method enables miRNA expression profiling from as little as 10 pg of total RNA and is suitable for high-throughput miRNA expression analysis.

β-Actin—an unsuitable internal control for RT-PCR

Despite reports confirming cell-cycle dependent gene expression and a number of studies describing specific circumstances in which β-actin is also regulated, the mRNA for β-actin remains a widely used housekeeping gene internal control. Utilizing differential reverse transcriptase-polymerase chain reaction (RT-PCR), we report here the dose-dependent inhibition of β-actin by matrigel. This was detected by comparison to the very moderate inhibition of the target gene, membrane type-1 matrix metalloproteinase (MT1-MMP), with results independently confirmed by similar findings on MT1-MMP expression using competitive RT-PCR. Furthermore, RT-PCR of the housekeeping gene 18 Svedberg Units (S) rRNA demonstrated excellent consistency, reproducibility and non-regulation by a matrigel treatment. We conclude that β-actin is highly regulated by matrigel and therefore unsuitable as an internal control in this treatment. Hence, these findings suggest that researchers have a responsibility to ensure that the housekeeping gene of choice is not regulated in their specific application, as such regulation may dramatically affect the accuracy of their results. This study reinforces the necessity for minimally regulated housekeeping genes such as 18S rRNA, and the superiority of competitive templates as internal controls for quantitative applications of RT-PCR.

Retinal VEGF mRNA measured by SYBR Green I fluorescence: A versatile approach to quantitative PCR

PURPOSE: To determine whether continuous monitoring of SYBR Green I fluorescence provides a reliable and flexible method of quantitative RT-PCR. Our aims were (i) to test whether SYBR Green I analysis could quantify a wide range of known VEGF template concentrations, (ii) to apply this method in an experimental model, and (iii) to determine whether 20 existing primer pairs could be used to quantify their cognate mRNAs.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Análise da expressão dos genes STEAP1 e STEAP2 em adenocarcinomas de próstata por RT-PCR quantitativa em tempo real

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Specific detection of enterovirus 71 directly from clinical specimens using real-time RT-PCR hybridization probe assay

Enterovirus 71 (EV71) is one of the main causative agents of hand, foot and mouth disease (HFMD) in young children. Infections caused by EV71 could lead to many complications, ranging from brainstem encephalitis to pulmonary oedema, resulting in high mortality. Thus, rapid detection of the virus is required to enable measures to be implemented in preventing widespread transmission. Based on primers and probes targeting at the VP1 region, a real-time reverse-transcriptase polymerase chain reaction (RT-PCR) hybridization probe assay was developed for specific detection of EV71 from clinical specimens. Quantitative analysis showed that the assay was able to detect as low as 5 EV71 viral copies and EV71 was detected from 46 of the 55 clinical specimens obtained from pediatric patients suffering from HFMD during the period from 2000 to 2003 in Singapore. This study showed that the single tube real-time RT-PCR assay developed in this study can be applied as a rapid and sensitive method for specific detection of EV71 directly from clinical specimens. (c) 2005 Elsevier Ltd. All rights reserved.

Identification of circulating tumour cells in early stage breast cancer patients using multi marker immunobead RT-PCR

Introduction The ability to screen blood of early stage operable breast cancer patients for circulating tumour cells is of potential importance for identifying patients at risk of developing distant relapse. We present the results of a study of the efficacy of the immunobead RT-PCR method in identifying patients with circulating tumour cells. Results Immunomagnetic enrichment of circulating tumour cells followed by RT-PCR (immunobead RT-PCR) with a panel of five epithelial specific markers (ELF3, EPHB4, EGFR, MGB1 and TACSTD1) was used to screen for circulating tumour cells in the peripheral blood of 56 breast cancer patients. Twenty patients were positive for two or more RT-PCR markers, including seven patients who were node negative by conventional techniques. Significant increases in the frequency of marker positivity was seen in lymph node positive patients, in patients with high grade tumours and in patients with lymphovascular invasion. A strong trend towards improved disease free survival was seen for marker negative patients although it did not reach significance (p = 0.08). Conclusion Multi-marker immunobead RT-PCR analysis of peripheral blood is a robust assay that is capable of detecting circulating tumour cells in early stage breast cancer patients.

Matrix metalloproteinase localisation by in situ-RT-PCR in archival human breast biopsy material

Utilising archival human breast cancer biopsy material we examined the stromal/epithelial interactions of several matrix metalloproteinases (MMPs) using in situ-RT-PCR (IS-RT-PCR). In breast cancer, the stromal/epithelial interactions that occur, and the site of production of these proteases, are central to understanding their role in invasive and metastatic processes. We examined MT1-MMP (MMP-14, membrane type-1-MMP), MMP-1 (interstitial collagenase) and MMP-3 (stromelysin-1) for their localisation profile in progressive breast cancer biopsy material (poorly differentiated invasive breast carcinoma (PDIBC), invasive breast carcinomas (IBC) and lymph node metastases (LNM)). Expression of MT1-MMP, MMP-1 and MMP-3 was observed in both the tumour epithelial and surrounding stromal cells in most tissue sections examined. MT1-MMP expression was predominantly localised to the tumour component in the pre-invasive lesions. MMP-1 gene expression was relatively well distributed between both tissue compartments, while MMP-3 demonstrated highest expression levels in the stromal tissue surrounding the epithelial tumour cells. The results demonstrate the ability to distinguish compartmental gene expression profiles using IS-RT-PCR. Further, we suggest a role for MT1-MMP in early tumour progression, expression of MMP-1 during metastasis and focal expression pattern of MMP-3 in areas of expansion. These expression profiles may provide markers for early breast cancer diagnoses and present potential therapeutic targets.

In vitro and in vivo MMP gene expression localisation by In Situ-RT-PCR in cell culture and paraffin embedded human breast cancer cell line xenografts

Background Members of the matrix metalloproteinase (MMP) family of proteases are required for the degradation of the basement membrane and extracellular matrix in both normal and pathological conditions. In vitro, MT1-MMP (MMP-14, membrane type-1-MMP) expression is higher in more invasive human breast cancer (HBC) cell lines, whilst in vivo its expression has been associated with the stroma surrounding breast tumours. MMP-1 (interstitial collagenase) has been associated with MDA-MB-231 invasion in vitro, while MMP-3 (stromelysin-1) has been localised around invasive cells of breast tumours in vivo. As MMPs are not stored intracellularly, the ability to localise their expression to their cells of origin is difficult. Methods We utilised the unique in situ-reverse transcription-polymerase chain reaction (IS-RT-PCR) methodology to localise the in vitro and in vivo gene expression of MT1-MMP, MMP-1 and MMP-3 in human breast cancer. In vitro, MMP induction was examined in the MDA-MB-231 and MCF-7 HBC cell lines following exposure to Concanavalin A (Con A). In vivo, we examined their expression in archival paraffin embedded xenografts derived from a range of HBC cell lines of varied invasive and metastatic potential. Mouse xenografts are heterogenous, containing neoplastic human parenchyma with mouse stroma and vasculature and provide a reproducible in vivo model system correlated to the human disease state. Results In vitro, exposure to Con A increased MT1-MMP gene expression in MDA-MB-231 cells and decreased MT1-MMP gene expression in MCF-7 cells. MMP-1 and MMP-3 gene expression remained unchanged in both cell lines. In vivo, stromal cells recruited into each xenograft demonstrated differences in localised levels of MMP gene expression. Specifically, MDA-MB-231, MDA-MB-435 and Hs578T HBC cell lines are able to influence MMP gene expression in the surrounding stroma. Conclusion We have demonstrated the applicability and sensitivity of IS-RT-PCR for the examination of MMP gene expression both in vitro and in vivo. Induction of MMP gene expression in both the epithelial tumour cells and surrounding stromal cells is associated with increased metastatic potential. Our data demonstrate the contribution of the stroma to epithelial MMP gene expression, and highlight the complexity of the role of MMPs in the stromal-epithelial interactions within breast carcinoma.