978 resultados para Positional cloning


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Aniridia (AN) is a congenital, panocular disorder of the eye characterized by the complete or partial absence of the iris. The disease can occur in both the sporadic and familial forms which, in the latter case, is inherited as an autosomal dominant trait with high penetrance. The objective of this study was to isolate and characterize the genes involved in AN and Sey, and thereby to gain a better understanding of the molecular basis of the two disorders.^ Using a positional cloning strategy, I have approached and cloned from the AN locus in human chromosomal band 11p13 a cDNA that is deleted in two patients with AN. The deletions in these patients overlap by about 70 kb and encompass the 3$\sp\prime$ end of the cDNA. This cDNA detects a 2.7 kb mRNA encoded by a transcription unit estimated to span approximately 50 kb of genomic DNA. The message is specifically expressed in all tissues affected in all forms of AN, namely within the presumptive iris, lens, neuroretina, the superficial layers of the cornea, the olfactory bulbs, and the cerebellum. Sequence analysis of the AN cDNA revealed a number of motifs characteristic of certain transcription factors. Chief among these are the presence of the paired domain, the homeodomain, and a carboxy-terminal domain rich in serine, threonine and proline residues. The overall structure shows high homology to the Drosophila segmentation gene paired and members of the murine Pax family of developmental control genes.^ Utilizing a conserved human genomic DNA sequence as probe, I was able to isolate an embryonic murine cDNA which is over 92% homologous in nucleotide sequence and virtually identical at the amino acid level to the human AN cDNA. The expression pattern of the murine gene is the same as that in man, supporting the conclusion that it probably corresponds to the Sey gene. Its specific expression in the neuroectodermal component of the eye, in glioblastomas, but not in the neural crest-derived PC12 pheochromocytoma cell line, suggests that a defect in neuroectodermal rather mesodermal development might be the common etiological factor underlying AN and Sey. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Retinitis pigmentosa (RP) is an inherited retinal degenerative disease that is the leading cause of inherited blindness worldwide. Characteristic features of the disease include night blindness, progressive loss of visual fields, and deposition of pigment on the retina in a bone spicule-like pattern. RP is marked by extreme genetic heterogeneity with at least 19 autosomal dominant, autosomal recessive and X-linked loci identified. RP10, which maps to chromosome 7q, was the fifth autosomal dominant RP locus identified, and accounts for the early-onset disease in two independent families. Extensive linkage and haplotype analyses have been performed in these two families which have allowed the assignment of the disease locus to a 5-cM region on chromosome 7q31.3. In collaboration with Dr. Eric Green (National Center for Human Genome Research, National Institutes of Health), a well-characterized physical map of the region was constructed which includes YAC, BAC and cosmid coverage. The entire RP10 critical region resides within a 9-Mb well-characterized YAC contig. These physical maps not only provided the resources to undertake the CAIGES (cDNA amplification for identification of genomic expressed sequences) procedure for identification of retinal candidate genes within the critical region, but also identified a number of candidate genes, including transducin-$\gamma$ and blue cone pigment genes. All candidate genes examined were excluded. In addition, a number of ESTs were mapped within the critical region. EST20241, which was isolated from an eye library, corresponded to the 3$\sp\prime$ region of the ADP-ribosylation factor (ARF) 5 gene. ARF5, with its role in vesicle transport and possible participation in the regulation of the visual transduction pathway, became an extremely interesting candidate gene. Using a primer walking approach, the entire 3.2 kb genomic sequence of the ARF5 gene was generated and developed intronic primers to screen for coding region mutations in affected family members. No mutations were found in the ARF5 gene, however, a number of additional ESTs have been mapped to the critical region, and, as the large-scale sequencing projects get underway, megabases of raw sequence data from the RP10 region are becoming available. These resources will hasten the isolation and characterization of the RP10 gene. ^

Relevância:

100.00% 100.00%

Publicador:

Resumo:

To accelerate gene isolation from plants by positional cloning, vector systems suitable for both chromosome walking and genetic complementation are highly desirable. Therefore, we developed a transformation-competent artificial chromosome (TAC) vector, pYLTAC7, that can accept and maintain large genomic DNA fragments stably in both Escherichia coli and Agrobacterium tumefaciens. Furthermore, it has the cis sequences required for Agrobacterium-mediated gene transfer into plants. We cloned large genomic DNA fragments of Arabidopsis thaliana into the vector and showed that most of the DNA fragments were maintained stably. Several TAC clones carrying 40- to 80-kb genomic DNA fragments were transferred back into Arabidopsis with high efficiency and shown to be inherited faithfully among the progeny. Furthermore, we demonstrated the practical utility of this vector system for positional cloning in Arabidopsis. A TAC contig was constructed in the region of the SGR1 locus, and individual clones with ca. 80-kb inserts were tested for their ability to complement the gravitropic defects of a homozygous mutant line. Successful complementation enabled the physical location of SGR1 to be delimited with high precision and confidence.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The central problem of complex inheritance is to map oligogenes for disease susceptibility, integrating linkage and association over samples that differ in several ways. Combination of evidence over multiple samples with 1,037 families supports loci contributing to asthma susceptibility in the cytokine region on 5q [maximum logarithm of odds (lod) = 2.61 near IL-4], but no evidence for atopy. The principal problems with retrospective collaboration on linkage appear to have been solved, providing far more information than a single study. A multipoint lod table evaluated at commonly agreed reference loci is required for both collaboration and metaanalysis, but variations in ascertainment, pedigree structure, phenotype definition, and marker selection are tolerated. These methods are invariant with statistical methods that increase the power of lods and are applicable to all diseases, motivating collaboration rather than competition. In contrast to linkage, positional cloning by allelic association has yet to be extended to multiple samples, a prerequisite for efficient combination with linkage and the greatest current challenge to genetic epidemiology.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Paget's disease of bone is a common condition characterized by bone pain, deformity, pathological fracture, and an increased incidence of osteosarcoma. Genetic factors play a role in the pathogenesis of Paget's disease but the molecular basis remains largely unknown. Susceptibility loci for Paget's disease of bone have been mapped to chromosome 6p21.3 (PDB1) and 18q121.1-q22 (PDB2) in different pedigrees, We have identified a large pedigree of over 250 individuals with 49 informative individuals affected with Paget's disease of bone; 31 of whom are available for genotypic analysis. The disease is inherited as an autosomal dominant trait in the pedigree with high penetrance by the sixth decade. Linkage analysis has been performed with markers at PDB1; these data show significant exclusion of linkage with log,, of the odds ratio (LOD) scores < -2 in this region. Linkage analysis of microsatellite markers from the PDB2 region has excluded linkage with this region, with a 30 cM exclusion region (LOD score < -2.0) centered on D18S42, These data confirm the genetic heterogeneity of Paget's disease of bone. Our hypothesis is that a novel susceptibility gene relevant to the pathogenesis of Paget's disease of bone lies elsewhere in the genome in the affected members of this pedigree and will be identified using a microsatellite genomewide scan followed by positional cloning.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

BACKGROUND: Establishing the genetic basis of phenotypes such as skeletal dysplasia in model organisms can provide insights into biologic processes and their role in human disease. METHODS: We screened mutagenized mice and observed a neonatal lethal skeletal dysplasia with an autosomal recessive pattern of inheritance. Through genetic mapping and positional cloning, we identified the causative mutation. RESULTS: Affected mice had a nonsense mutation in the thyroid hormone receptor interactor 11 gene (Trip11), which encodes the Golgi microtubule-associated protein 210 (GMAP-210); the affected mice lacked this protein. Golgi architecture was disturbed in multiple tissues, including cartilage. Skeletal development was severely impaired, with chondrocytes showing swelling and stress in the endoplasmic reticulum, abnormal cellular differentiation, and increased cell death. Golgi-mediated glycosylation events were altered in fibroblasts and chondrocytes lacking GMAP-210, and these chondrocytes had intracellular accumulation of perlecan, an extracellular matrix protein, but not of type II collagen or aggrecan, two other extracellular matrix proteins. The similarities between the skeletal and cellular phenotypes in these mice and those in patients with achondrogenesis type 1A, a neonatal lethal form of skeletal dysplasia in humans, suggested that achondrogenesis type 1A may be caused by GMAP-210 deficiency. Sequence analysis revealed loss-of-function mutations in the 10 unrelated patients with achondrogenesis type 1A whom we studied. CONCLUSIONS: GMAP-210 is required for the efficient glycosylation and cellular transport of multiple proteins. The identification of a mutation affecting GMAP-210 in mice, and then in humans, as the cause of a lethal skeletal dysplasia underscores the value of screening for abnormal phenotypes in model organisms and identifying the causative mutations.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The HERC gene family encodes proteins with two characteristic domains: HECT and RCC1-like. Proteins with HECT domain shave been described to function as ubiquitin ligases, and those that contain RCC1-like domains have been reported to function as GTPases regulators. These two activities are essential in a number of important cellular processes such as cell cycle, cell signaling, and membrane trafficking. Mutations affecting these domains have been found associated with retinitis pigmentosa, amyotrophic lateral sclerosis, and cancer. In humans, six HERC genes have been reported which encode two subgroups of HERC proteins: large (HERC1-2) and small (HERC3-6). The giant HERC1 protein was the first to be identified. It has been involved in membrane trafficking and cell proliferation/growth through its interactions with clathrin, M2-pyruvate kinase, and TSC2 proteins. Mutations affecting other members of the HERC family have been found to be associated with sterility and growth retardation. Here, we report the characterization of a recessive mutation named tambaleante, which causes progressive Purkinje cell degeneration leading to severe ataxia with reduced growth and lifespan in homozygous mice aged over two months. We mapped this mutation in mouse chromosome 9 and then performed positional cloning. We found a GuA transition at position 1448, causing a Gly to Glu substitution (Gly483Glu) in the highly conserved N- terminal RCC1-like domain of the HERC1 protein. Successful transgenic rescue, with either a mouse BAC containing the normal copy of Herc1 or with the human HERC1 cDNA, validated our findings. Histological and biochemical studies revealed extensive autophagy associated with an increase of the mutant protein level and a decrease of mTOR activity. Our observations concerning this first mutation in the Herc1 gene contribute to the functional annotation of the encoded E3 ubiquitin ligase and underline the crucial and unexpected role of this protein in Purkinje cell physiology.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

When compared to other model organisms whose genome is sequenced, the number of mutations identified in the mouse appears extremely reduced and this situation seriously hampers our understanding of mammalian gene function(s). Another important consequence of this shortage is that a majority of human genetic diseases still await an animal model. To improve the situation, two strategies are currently used: the first makes use of embryonic stem cells, in which one can induce knockout mutations almost at will; the second consists of a genome-wide random chemical mutagenesis, followed by screening for mutant phenotypes and subsequent identification of the genetic alteration(s). Several projects are now in progress making use of one or the other of these strategies. Here, we report an original effort where we mutagenized BALB/c males, with the mutagen ethylnitrosourea. Offspring of these males were screened for dominant mutations and a three-generation breeding protocol was set to recover recessive mutations. Eleven mutations were identified (one dominant and ten recessives). Three of these mutations are new alleles (Otop1mlh, Foxn1sepe and probably rodador) at loci where mutations have already been reported, while 4 are new and original alleles (carc, eqlb, frqz, and Sacc). This result indicates that the mouse genome, as expected, is far from being saturated with mutations. More mutations would certainly be discovered using more sophisticated phenotyping protocols. Seven of the 11 new mutant alleles induced in our experiment have been localized on the genetic map as a first step towards positional cloning.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Thèse réalisée en cotutelle avec l'Université Pierre et Marie Curie, Paris 6(UPMC, Paris, France).

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Depuis déjà plusieurs décennies, nous sommes en mesure d'identifier les mutations responsable de diverses maladies mendéliennes. La découverte des gènes responsables de ces maladies permet non seulement un meilleur diagnostic clinique pour ces familles, mais aussi de mieux comprendre les mécanismes physiopathologiques de ces maladies ainsi que mieux définir la fonction normale des gènes causales. Ultimement, ces découvertes mènent à l'identification de cibles thérapeutiques pour le traitement de ces maladies. Les progrès technologiques sont depuis toujours un facteur très important dans la découverte de ces gènes mutés. De l'approche traditionnelle de clonage positionnel en passant par la première séquence du génome humain et maintenant les technologies de séquençage à grande échelle, de plus en plus de maladies ont maintenant une entité génétique. Dans le cadre de ce projet de doctorat, nous avons utilisé tant les approches traditionnelles (leucodystrophies) que les nouvelles technologies de séquençage (polyneuropathie douloureuse) qui ont mené à l'identification du gène causal pour plusieurs de nos familles. L'efficacité de ces deux approches n'est plus à démontrer, chacune d'entre elles possèdent des avantages et des inconvénients. Dans le cadre de ces projets, nous avons utilisé la population canadienne-française connue pour ces effets fondateurs et la présence, encore aujourd'hui, de grandes familles. Les différents projets ont permis d'établir certains avantages et inconvénients quant à l'utilisation de ces techniques et de la population canadienne-française. Dans le cadre d'un phénotype assez homogène et bien défini comme celui du projet leucodystrophie, l'approche traditionnel par gène candidat nous a permis d'identifier le gène causal, POLR3B, sans trop de difficulté. Par contre, pour les autres projets où nous sommes en présence d'une hétérogénéité clinique et génétique une approche non-biaisée utilisant le séquençage exomique a obtenu un plus grand succès. La présence de grandes familles est un grand avantage dans les deux approches. Dans le projet polyneuropathie douloureuse, une grande famille originaire du Saguenay-Lac-St-Jean nous a permis d'identifier le gène NAGLU comme responsable suite à l'exclusion des autres variants candidats par analyse de ségrégation. Comme NAGLU était déjà associé à un phénotype qui diffère sur plusieurs points à celui de notre famille, une approche traditionnelle n'aurait pas été en mesure d'identifier NAGLU comme le gène causal. Dans l'analyse de nos données de séquençage exomique, nous avons observé que plusieurs variants rares, absents des bases de données, étaient partagés entre les différents individus Canadiens français. Ceci est probablement dû à la démographie génétique particulière observée chez les Canadiens français. En conclusion, les technologies de séquençage à grande échelle sont avantageuses dans l'étude de maladies hétérogènes au niveau clinique et génétique. Ces technologies sont en voie de modifier l'approche d'identification de gènes en permettant une analyse de génétique inversée, c'est-à-dire de la génétique vers la clinique.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Fragaria vesca is a short-lived perennial with a seasonal-flowering habit. Seasonality of flowering is widespread in the Rosaceae and is also found in the majority of temperate polycarpic perennials. Genetic analysis has shown that seasonal flowering is controlled by a single gene in F. vesca, the SEASONAL FLOWERING LOCUS (SFL). Here, we report progress towards the marker-assisted selection and positional cloning of SFL, in which three ISSR markers linked to SFL were converted to locus-specific sequence-characterized amplified region (SCAR1–SCAR3) markers to allow large-scale screening of mapping progenies. We believe this is the first study describing the development of SCAR markers from ISSR profiles. The work also provides useful insight into the nature of polymorphisms generated by the ISSR marker system. Our results indicate that the ISSR polymorphisms originally detected were probably caused by point mutations in the positions targeted by primer anchors (causing differential PCR failure), by indels within the amplicon (leading to variation in amplicon size) and by internal sequence differences (leading to variation in DNA folding and so in band mobility). The cause of the original ISSR polymorphism was important in the selection of appropriate strategies for SCAR-marker development. The SCAR markers produced were mapped using a F. vesca f. vesca × F. vesca f. semperflorens testcross population. Marker SCAR2 was inseparable from the SFL, whereas SCAR1 mapped 3.0 cM to the north of the gene and SCAR3 1.7 cM to its south.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Ingestion of caesium (Cs) radioisotopes poses a health risk to humans. Crop varieties that accumulate less Cs in their edible tissues may provide a useful countermeasure. This study was performed to determine whether quantitative genetics on a model plant (Arabidopsis thaliana) might inform such 'safe'-crop strategies. Arabidopsis accessions and recombinant inbred lines (RILs), from Landsberg erecta (Ler) x Cape Verdi Island (Cvi), Ler x Columbia (Col), and Niederzenz (Nd) x Col mapping populations, were grown on agar supplemented with subtoxic levels of Cs. Shoot Cs concentration varied up to three-fold, and shoot f. wt varied up to 25-fold within populations. The heritability of growth and Cs accumulation traits ranged from 0.06 to 0.28. Four quantitative trait loci (QTL) accounted for > 80 of the genetic contribution to the total phenotypic variation in shoot Cs concentration in the Ler x Col population. QTL identified in this study, in particular, QTL co-localizing to the top and bottom regions of Chromosomes I and V in two different mapping populations, are amenable to positional cloning and, through collinearity, may inform selection or breeding strategies for the development of 'safe' crops.