998 resultados para Normal skin
Resumo:
Cryosurgery is an efficient therapeutic technique used to treat benign and malignant cutaneous diseases. The primary active mechanism of cryosurgery is related to vascular effects on treated tissue. After a cryosurgical procedure, exuberant granulation tissue is formed at the injection site, probably as a result of angiogenic stimulation of the cryogen and inflammatory response, particularly in endothelial cells. To evaluate the angiogenic effects of freezing, as part of the phenomenon of healing rat skin subjected to previous injury. Two incisions were made in each of the twenty rats, which were divided randomly into two groups of ten. After 3 days, cryosurgery with liquid nitrogen was performed in one of incisions. The rats' samples were then collected, cut and stained to conduct histopathological examination, to assess the local angiogenesis in differing moments and situations. It was possible to demonstrate that cryosurgery, in spite of promoting cell death and accentuated local inflammation soon after its application, induces quicker cell proliferation in the affected tissue and maintenance of this rate in a second phase, than in tissue healing without this procedure. These findings, together with the knowledge that there is a direct relationship between mononuclear cells and neovascularization (the development of a rich system of new vessels in injury caused by cold), suggest that cryosurgery possesses angiogenic stimulus, even though complete healing takes longer to occur. The significance level for statistical tests was 5% (p<0,05).
Resumo:
Fibroblasts are thought to be partially responsible for the persisting contractile forces that result in burn contractures. Using a monolayer cell culture and fibroblast populated collagen lattice (FPCL) three-dimensional model we subjected hypertrophic scar and non-cicatricial fibroblasts to the antifibrogenic agent pentoxifylline (PTF - 1 mg/mL) in order to reduce proliferation, collagen types I and III synthesis and model contraction. Fibroblasts were isolated from post-burn hypertrophic scars (HSHF) and non-scarred skin (NHF). Cells were grown in monolayers or incorporated into FPCL`s and exposed to PTF. In monolayer, cell number proliferation was reduced (46.35% in HSHF group and 37.73% in NHF group, p < 0.0001). PTF selectively inhibited collagen III synthesis in the HSHF group while inhibition was more evident to type I collagen synthesis in the NHF group. PTF also reduced contraction in both (HSHF and NHF) FPCL. (C) 2009 Elsevier Ltd and ISBI. All rights reserved.
Resumo:
Dysregulation of the skin immune system (SIS) could explain the high prevalence of skin disorders in HIV+ individuals. The present study was carried out to determine whether alterations in the cell population of SIS and epidermal immunoactivation occur in the normal skin of HIV+ individuals. Forty-five biopsies were taken from the normal upper arm skin of 45 HIV+ patients and of 15 healthy controls. HIV+ individuals were divided into three categories according to their CD4 cell blood count (<200, 200-499 and ³500/µl). Hematoxylin-eosin was used to stain tissue sections for morphological analysis and immunohistochemistry was used for the evaluation of the frequency of macrophages, Langerhans cells, and CD lymphocyte subsets. In addition, semiquantitative analysis of LFA-1, ICAM-1 and HLA-DR was determined in epidermal cells. Macrophages, Langerhans cells, and CD lymphocyte subsets did not differ significantly between any of the patient categories and the control group. When all HIV+ individuals were compared as a group to the control group, a significant increase in dermal CD8+ T lymphocytes (P < 0.01) and lower CD4-CD8 ratios (P < 0.01) were observed in the HIV+ individuals. Epidermal ICAM-1 and HLA-DR expression was negative in both HIV+ and normal skin biopsies. No evidence of a depletion of the SIS population or of epidermal immunoactivation in normal skin from HIV+ individuals was demonstrable, suggesting that alterations in the central immune system are not necessarily reflected in the SIS of HIV-infected patients.
Resumo:
Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.
Resumo:
Objective: Raman spectroscopy has been employed to discriminate between malignant (basal cell carcinoma [BCC] and melanoma [MEL]) and normal (N) skin tissues in vitro, aimed at developing a method for cancer diagnosis. Background data: Raman spectroscopy is an analytical tool that could be used to diagnose skin cancer rapidly and noninvasively. Methods: Skin biopsy fragments of similar to 2 mm(2) from excisional surgeries were scanned through a Raman spectrometer (830 nm excitation wavelength, 50 to 200 mW of power, and 20 sec exposure time) coupled to a fiber optic Raman probe. Principal component analysis (PCA) and Euclidean distance were employed to develop a discrimination model to classify samples according to histopathology. In this model, we used a set of 145 spectra from N (30 spectra), BCC (96 spectra), and MEL (19 spectra) skin tissues. Results: We demonstrated that principal components (PCs) 1 to 4 accounted for 95.4% of all spectral variation. These PCs have been spectrally correlated to the biochemicals present in tissues, such as proteins, lipids, and melanin. The scores of PC2 and PC3 revealed statistically significant differences among N, BCC, and MEL (ANOVA, p < 0.05) and were used in the discrimination model. A total of 28 out of 30 spectra were correctly diagnosed as N, 93 out of 96 as BCC, and 13 out of 19 as MEL, with an overall accuracy of 92.4%. Conclusions: This discrimination model based on PCA and Euclidean distance could differentiate N from malignant (BCC and MEL) with high sensitivity and specificity.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Background: Hydration and integrity of the horny layer is essential to normal skin function. Objective: Comparison of the hydrating properties of three moisturizers with pimecrolimus cream vehicle. Methods: Four test preparations (high-quality skin cream, cold cream emulsion, emollient oil, pimecrolimus cream vehicle) were applied to four different regions of the forearms and legs. Transepidermal water loss (TEWL) was assessed by evaporimetry at baseline, and 3 and 6 hours after arm application, and electrical capacitance was assessed by corneometry at baseline, and 1, 2, 3 and 6 hours after leg application. Results: Corneometry assessment - in terms of efficacy in moisturizing the skin, test preparations were ranked (best to worst): high-quality skin cream (45.9 arbitrary units versus 75.3; p < 0.001) > pimecrolimus vehicle cream (46.6 versus 61.5; p < 0.001) > emollient oil (43.5 versus 54.8; p = 0.006) > cold cream emulsion (44.8 versus 49.9; p = 0.738). Untreated skin (control) had a mean capacitance of 44.8 units at baseline and 48.5 units at endpoint. Evaporimetry (assessment of TEWL) revealed no significant differences between control and any test preparation at any timepoint. Conclusions: Pimecrolimus cream vehicle has skin hydration properties comparable with highly effective commercially available products. No test preparation had a significant effect on TEWL.
Resumo:
Ticks deposit saliva at the site of their attachment to a host in order to inhibit haemostasis, inflammation and innate and adaptive immune responses. The anti-haemostatic properties of tick saliva have been described by many studies, but few show that tick infestations or its anti-haemostatic components exert systemic effects in vivo. In the present study, we extended these observations and show that, compared with normal skin, bovine hosts that are genetically susceptible to tick infestations present an increase in the clotting time of blood collected from the immediate vicinity of haemorrhagic feeding pools in skin infested with different developmental stages of Rhipicepahlus microplus; conversely, we determined that clotting time of tick-infested skin from genetically resistant bovines was shorter than that of normal skin. Coagulation and inflammation have many components in common and we determined that in resistant bovines, eosinophils and basophils, which are known to contain tissue factor, are recruited in greater numbers to the inflammatory site of tick bites than in susceptible hosts. Finally, we correlated the observed differences in clotting times with the expression profiles of transcripts for putative anti-haemostatic proteins in different developmental stages of R. microplus fed on genetically susceptible and resistant hosts: we determined that transcripts coding for proteins similar to these molecules are overrepresented in salivary glands from nymphs and males fed on susceptible bovines. Our data indicate that ticks are able to modulate their host`s local haemostatic reactions. In the resistant phenotype, larger amounts of inflammatory cells are recruited and expression of anti-coagulant molecules is decreased tick salivary glands, features that can hamper the tick`s blood meal. (C) 2010 Elsevier Inc. All rights reserved.
Resumo:
Les interactions épithélio-mésenchymateuses jouent un rôle important dans le contrôle du développement normal de la peau, son homéostasie et sa tumorigenèse. Les fibroblastes dermiques (DFs) représentent la catégorie cellulaire la plus abondante dans le stroma et leur rôle est de plus en plus considéré. En ce qui concerne particulièrement la tumorigenèse, des facteurs diffusibles produits par les fibroblastes entourant les tumeurs épithéliales, appelés 'fibroblastes associés au cancer (CAF)', interagissent au niveau de l'inflammation impliquée directement ou indirectement dans la signalisation paracrine, entre le stroma et les cellules épiéliales cancéreuses. Le risque de cancer de la peau augmente de façon exponentielle avec l'âge. Comme un lien probable entre les deux, la sénescence des fibroblastes résulte de la production du sécrétome favorisant la sénescence (SMS), un groupe de facteurs diffusibles induisant une stimulation paracrine de la croissance, l'inflammation et le remodelage de la matrice. De façon fort intéressante, l'induction de ces gènes est aussi une caractéristique des CAFs. Cependant, le lien entre les deux événements cellulaires sénescence et activation des CAFs reste en grande partie inexploré. L'ATF3 (Activating Transcription Factor 3) est un facteur de transcription induit en réponse au stress, dont les fonctions sont hautement spécifiques du type cellulaire. Bien qu'il ait été découvert dans notre laboratoire en tant que promoteur de tumeurs dans les kératinocytes, ses fonctions biologique et biochimique dans le derme n'ont pas encore été étudiées. Récemment, nous avons constaté que, chez la souris, l'abrogation de la voie de signalisation de Notch/CSL dans les DFs, induisait la formation de tumeurs kératinocytaires multifocales. Ces dernières proviennent de la cancérisation en domaine, un phénomène associé à une atrophie du stroma, des altérations de la matrice et de l'inflammation. D'autres études ont montré que CSL agissait comme un régulateur négatif de gènes impliqués dans sénescence des DFs et dans l'activation des CAFs. Ici, nous montrons que la suppression ou l'atténuation de l'expression de ATF3 dans les DFs induit la sénescence et l'expression des gènes liés aux CAFs, de façon similaire à celle déclenchée par la perte de CSL, tandis que la surexpression de ATF3 supprime ces changements. Nous émettons l'hypothèse que ATF3 joue un rôle suppresseur dans l'activation des CAFs et dans la progression des tumeurs kératinocytaires, en surmontant les conséquences de l'abrogation de la voie de signalisation Notch/CSL. En concordance avec cette hypothèse, nous avons constaté que la perte de ATF3 dans les DFs favorisait la tumorigénicité des kératinocytes via le contrôle négatif de cytokines, des enzymes de la matrice de remodelage et de protéines associées au cancer, peut-être par liaison directe des effecteurs de la voie Notch/CSL : IL6 et les gènes Hes. Enfin, dans les échantillons cliniques humains, le stroma sous-jacent aux lésions précancéreuses de kératoses actiniques montre une diminution significative de l'expression de ATF3 par rapport au stroma jouxtant la peau normale. La restauration de l'expression de ATF3 pourrait être utilisée comme un outil thérapeutique en recherche translationnelle pour prévenir ou réprimer le processus de cancérisation en domaine. - Epithelial-mesenchymal interactions play an important role in control of normal skin development, homeostasis and tumorigenesis. The role of dermal fibroblasts (DFs) as the most abundant cell type in stroma is increasingly appreciated. Especially during tumorigenesis, fibroblasts surrounding epithelial tumors, called Cancer Associated Fibroblasts (CAFs), produce diffusible factors (growth factors, inflammatory cytokines, chemokines and enzymes, and matrix metalloproteinases) that mediate inflammation either directly or indirectly through paracrine signaling between stroma and epithelial cancer cells. The risk of skin cancer increases exponentially with age. As a likely link between the two, senescence of fibroblasts results in production of the senescence-messaging-secretome (SMS), a panel of diffusible factors inducing paracrine growth stimulation, inflammation, and matrix remodeling. Interestingly, induction of these genes is also a characteristic of Cancer Associated Fibroblasts (CAFs). However, the link between the two cellular events, senescence and CAF activation is largely unexplored. ATF3 is a key stress response transcription factor with highly cell type specific functions, which has been discovered as a tumor promoter in keratinocytes in our lab. However, the biological and biochemical function of ATF3 in the dermal compartment of the skin has not been studied yet. Recently, we found that compromised Notch/CSL signaling in dermal fibroblasts (DFs) in mice is a primary cause of multifocal keratinocyte tumors called field cancerization associated with stromal atrophy, matrix alterations and inflammation. Further studies showed that CSL functions as a negative regulator of genes involved in DFs senescence and CAF activation. Here, we show that deletion or silencing of the ATF3 gene in DFs activates senescence and CAF-related gene expression similar to that triggered by loss of CSL, while increased ATF3 suppresses these changes. We hypothesize that ATF3 plays a suppressing role in CAF activation and keratinocyte tumor progression, overcoming the consequences of compromised Notch/CSL signaling. In support of this hypothesis, we found that loss of ATF3 in DFs promotes tumorigenic behavior of keratinocytes via negative control of cytokines, matrix-remodeling enzymes and cancer-associated proteins, possibly through direct binding to Notch/CSL targets, IL6 and Hes genes. On the other hand, in human clinical samples, stromal fields underlying premalignant actinic keratosis lesions showed significantly decreased ATF3 expression relative to stroma of flanking normal skin. Restoration of ATF3, which is lost in cancer development, may be used as a therapeutic tool for translational research to prevent or suppress the field cancerization process.
Resumo:
We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients), and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients). Prevalence of bacteria isolated by culture methods was 90.9% (10/11). We cultured, from chiclero's ulcers (60%), pathogenic bacterial such as Staphylococcus aureus (20%), S. pyogenes (1.6%), Pseudomonas aeruginosa (1.6%), Morganella morganii (1.6%), and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%), Enterobacter spp. (20%), and Enterococcus spp. (20%). We also cultured coagulase-negative staphylococci in 40% (4/10) of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15) of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L.) mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.
Resumo:
INTRODUCTION: Smoothelin is a cytoskeletal protein of differentiated smooth muscle cells with contractile capacity, distinguishing it from other smooth muscle proteins, such as smooth muscle actin (SMA). OBJECTIVE: To evaluate the expression of smoothelin and SMA in the skin in order to establish specific localizations of smoothelin in smooth muscle cells with high contractile capacity and in the epithelial component of cutaneous adnexal structures. Methods: Immunohistochemical analysis (smoothelin and SMA) was performed in 18 patients with normal skin. RESULTS: SMA was expressed by the vascular structures of superficial, deep, intermediate and adventitial plexuses, whereas smoothelin was specifically expressed in the cytoplasm of smooth muscle cells of the deepest vascular plexus and in no other plexus of the dermis. The hair erector muscle showed intense expression of smoothelin and SMA. Cells with nuclear expression of smoothelin and cytoplasmic expression of SMA were observed in the outer root sheath of the inferior portion of the hair follicles and intense cytoplasmic expression in cells of the dermal sheath to SMA. CONCLUSIONS: We report the first study of smoothelin expression in normal skin, which differentiates the superficial vascular plexus from the deep. The deep plexus comprises vessels with high contractile capacity, which is important for understanding dermal hemodynamics in normal skin and pathological processes. We suggest that the function of smoothelin in the outer root sheath may be to enhance the function of SMA, which has been related to mechanical stress. Smoothelin has not been studied in cutaneous pathology; however we believe it may be a marker specific for the diagnosis of leiomyomas and leiomyosarcomas of the skin. Also, smoothelin could differentiate arteriovenous malformations of cavernous hemangioma of the skin
Resumo:
Localised cutaneous leishmaniasis (LCL) is the most common form of cutaneous leishmaniasis characterised by single or multiple painless chronic ulcers, which commonly presents with secondary bacterial infection. Previous culture-based studies have found staphylococci, streptococci, and opportunistic pathogenic bacteria in LCL lesions, but there have been no comparisons to normal skin. In addition, this approach has strong bias for determining bacterial composition. The present study tested the hypothesis that bacterial communities in LCL lesions differ from those found on healthy skin (HS). Using a high throughput amplicon sequencing approach, which allows for better populational evaluation due to greater depth coverage and the Quantitative Insights Into Microbial Ecology pipeline, we compared the microbiological signature of LCL lesions with that of contralateral HS from the same individuals.Streptococcus, Staphylococcus,Fusobacterium and other strict or facultative anaerobic bacteria composed the LCL microbiome. Aerobic and facultative anaerobic bacteria found in HS, including environmental bacteria, were significantly decreased in LCL lesions (p < 0.01). This paper presents the first comprehensive microbiome identification from LCL lesions with next generation sequence methodology and shows a marked reduction of bacterial diversity in the lesions.