The ratio of messenger RNA levels of receptor activator of nuclear factor kappa B ligand to osteoprotegerin correlates with bone remodeling indices in normal human cancellous bone but not in osteoarthritis

skeletal disease. Bone remodeling is initiated by osteoclastic resorption followed by osteoblastic formation of new bone. Receptor activator of nuclear factor KB ligand (RANKL) is a newly described regulator of osteoclast formation and function, the activity of which appears to be a balance between interaction with its receptor RANK and with an antagonist binding protein osteoprotegerin (OPG). Therefore, we have examined the relationship between the expression of RANKL, RANK, and OPG and indices of bone structure and turnover in human cancellous bone from the proximal femur. Bone samples were obtained from individuals with osteoarthritis (OA) at joint replacement surgery and from autopsy controls. Histomorphometric analysis of these samples showed that eroded surface (ES/BS) and osteoid surface (OS/BS) were positively associated in both control (p < 0.001) and OA (p < 0.02), indicating that the processes of bone resorption and bone formation remain coupled in OA, as they are in controls. RANKL, OPG, and RANK messenger RNA, (mRNA) were abundant in human cancellous bone, with significant differences between control and OA individuals. In coplotting the molecular and histomorphometric data, strong associations were found between the ratio of RANKL/OPG mRNA and the indices of bone turnover (RANKL/OPG vs. ES/BS: r = 0.93, p < 0.001; RANKL/OPG vs. OS/BS: r = 0.80, p < 0.001). These relationships were not evident in trabecular bone from severe OA, suggesting that bone turnover may be regulated differently in this disease. We propose that the effective concentration of RANKL is related causally to bone turnover.

A soluble form of CD83 is released from activated dendritic cells and B lymphocytes, and is detectable in normal human sera

CD83 is an inducible glycoprotein expressed predominantly by dendritic cells (DC) and B lymphocytes. Expression of membrane CD83 (mCD83) is widely used as a marker of differentiated/ activated DC but its function and ligand(s) are presently unknown. We report the existence of a soluble form of CD83 (sCD83). Using both a sCD83-specific ELISA and Western blotting, we could demonstrate the release of sCD83 by mCD83(+) B cell and Hodgkin's disease-derived cell lines, but not mCD83(-) cells. Inhibition of de novo protein synthesis did not affect the release of sCD83 during short-term (2 h) culture of cell lines although mCD83 expression was significantly reduced, suggesting sCD83 is generated by the release of mCD83. Isolated tonsillar B lymphocytes and monocyte-derived DC, which are mCD83(low), released only low levels of sCD83 during culture. However, the differentiation/activation of these populations both up-regulated mCD83 and increased sCD83 release significantly. Analysis of sera from normal donors demonstrated the presence of low levels (121 +/- 3.6 pg/ml) of circulating sCD83. Further studies utilizing purified sCD83 and the analysis of sCD83 levels in disease may provide clues to the function and ligand(s) of CD83.

Placental growth hormone is not suppressed by oral glucose loading in normal human pregnancy

Placental growth hormone (PGH) progressively replaces pituitary growth hormone in the maternal circulation from mid-gestation onwards in human pregnancy. Our previous investigations have shown that placental growth hormone concentrations correlate well with foetal growth. Despite the apparent correlation between PGH and birthweight, the physiology of its secretion during pregnancy has not been well defined. We investigated the response of maternal serum PCH to oral glucose loading in pregnant women (n = 24) who demonstrated normal glucose tolerance at a mean gestation of 29 weeks. Mean (SEM) fasting PGH concentrations were high (36.9 [6.4] ng/ml). No suppression of PGH was noted at one, two or three hours after a 75 g oral glucose load. Similarly, no changes were noted in growth hormone binding protein or in calculated free PGH over the course of the glucose tolerance test. As expected, insulin concentrations rose sixfold and insulin like growth factor binding protein 1 concentrations fell by 20% with glucose loading. Cot-relation analysis showed maternal weight, BMI, fasting serum glucose serum insulin to be significantly correlated with the babies' birthweight. Our results support the proposition that PGH concentrations in maternal serum are not Suppressed by oral glucose loading in non-diabetic mothers.

Characterization and detection of naturally occurring antibodies against IL-1 alpha and IL-1 beta in normal human plasma.

During the development and testing of a radioreceptor assay (RRA) for human IL-1, we have detected and identified the presence of auto-antibodies to IL-1 in normal human plasma (NHP). The RRA is based on the competition between human 125I-labeled rIL-1 alpha and standard or unknown quantities of IL-1 alpha or IL-1 beta for binding to a limited amounts of IL-1 receptor (IL-1R) isolated from the EL4 mouse thymoma cell line. NHP from 20 out of 100 unselected blood donors were found to completely inhibit the binding of 125I-labeled IL-1 alpha to its receptor, suggesting the presence in these NHP samples of either abnormal amounts of IL-1 or of a factor binding to the 125I-labeled IL-1 alpha. Special care was taken to ascertain that the inhibitory factors were antibodies and not soluble IL-1 receptor antagonist. When plasma samples with inhibiting activity were incubated with labeled IL-1 alpha and chromatographed on a Sephadex G200 column, they were found to contain 125I-labeled complexes with an apparent molecular weight of 150-200kD. The IL-1 binding factor could be eliminated from plasma by incubation with protein A-Sepharose, suggesting that it consisted in IgG antibodies directed against IL-1. Furthermore, the antibody nature of the inhibiting factor was confirmed by its binding to purified rIL-1 coupled to Sepharose. Screening of 200 NHP samples by incubation with 100 pg of 125I-labeled IL-1 followed by precipitation with 12% of polyethylene glycol (PEG) confirmed that about 25% of NHP contain detectable IgG antibodies to IL-1 alpha, while only 2% of NHP contain antibodies to IL-1 beta. No correlation between the presence of these anti-IL-1 antibodies and any particular major histocompatibility complex or any pathological conditions was detected. We suggest that all serum samples assayed for IL-1 alpha or IL-1 beta content should be pretested with the PEG precipitation assay described here.

Immunohistochemical expression of endothelial markers CD31, CD34, von Willebrand Factor and Fli-1 in normal human tissues

Résumé du travail de thèse Introduction : Les différentes cellules endothéliales du lit vasculaire ont de nombreuses similitudes fonctionnelles et morphologiques. Cependant, elles présentent également une importante hétérogénéité structurelle et fonctionnelle qui peut avoir des implications notamment dans l'angiogenèse et le développement des maladies cardio-vasculaires. Peu d'études ont été publiées au sujet de l'expression et de la distribution des marqueurs endothéliaux dans les tissus humain normaux. Objectif : Nous avons étudié l'expression immunohistochimique des marqueurs endothéliaux CD31, CD34, vWF et Fli-1 dans les vaisseaux périphériques du rein, du poumon, de la rate, du foie, du cour et des gros vaisseaux ; incluant l'aorte, la veine cave inférieure, l'artère rénale ainsi que les artères et veines pulmonaires et fémorales. Matériel et méthodes : Les échantillons tissulaires ont été obtenus à partir de matériel d'autopsie et de biopsies. Le matériel a été fixé en formaline et inclus en paraffine. Les coupes de paraffine ont été colorées immunohistochimiquement avec CD31, CD34 et vWF. Les biopsies ont également été colorées immunohistochimiquement avec Fli-1, D2-40 et Lyve-1. Résultats : L'expression immunohistochimique de ces marqueurs est hétérogène dans les différents organes étudiés. Dans le rein, l'endothélium fenêtré des glomérules exprime fortement CD31 et CD34. Par contre, il n'exprime pas ou alors de manière faible et focale vWF. Dans le poumon, les capillaires alvéolaires expriment fortement CD31 et CD34 mais sont habituellement négatifs pour le vWF. L'expression de vWF augmente graduellement avec le calibre vasculaire dans le poumon. Les sinusoïdes de la rate expriment CD31 de manière diffuse mais ils n'expriment pas CD34. Les sinusoïdes du foie expriment CD31 de part et d'autre des lobules. Par contre, CD34 est exprimé seulement dans la région périportale. L'expression de Fli-1 dans les cellules endothéliales est ubiquitaire et ne varie pas suivant le type de vaisseau ou d'organe. Fli-1 est également exprimé dans d'autres types de cellules, essentiellement des lymphocytes. D2-40 est exprimé seulement dans l'endothélium des vaisseaux lymphatiques. L'expression de Lyve-1 dans ce matériel de routine était inconstante et non reproductible. Conclusion : Ces résultats indiquent que l'expression des marqueurs endothéliaux CD31, CD34 et vWF est hétérogène dans le lit vasculaire et qu'elle varie entre différents vaisseaux et différents compartiments anatomiques du même organe. D2-40 ne marque que les cellules endothéliales lymphatiques.

Isolation and characterization of carcinoembryonic antigen (CEA) extracted from normal human colon mucosa.

Carcinoembryonic antigen (CEA) was identified in perchloric acid (PCA)_extract from normal colon mucosa by 2 immunological criteria: a line of identity in double diffusion and a parallel inhibition curve in radioimmunoassay (RIA), both with reference colon carcinoma-CEA (CEA-Tu). The average concentration of CEA in normal colon mucosa (CEA-No) was 35 times lower than in primary large bowel carcinomas and 230 times lower than in metastatic colon or rectum carcinomas. CEA-No was purified from PCA extracts of normal colon mucosa by Sephadex G-200 filtration and immunoadsorbent columns. Purified CEA-No had quatitatively the same inhibition activity in RIA as the British Standard CEA coded 73/601. Purified CEA-No was labelled with 125I. The percentage of binding of labelled CEA-No to a specific goat anti-CEA-Tu antiserum was similar to that of CEA-Tu. Labelled CEA-No could be used as radioactive tracer in RIA as well as labelled CEA-Tu. The physico-chemical properties of purified CEA-Tu as demonstrated by Sepharose 6 B filtration, SDS Polyacrylamide gel analysis and cesium chloride density gradient, were found to be almost identical to those of reference CEA-Tu. Preliminary results showed that CEA-No and CEA-Tu contained the same types of carbohydrates in similar proportions. A rabbit antiserum against CEA-No was obtained which demonstrated the same specificity as conventional anti-CEA-Tu antisera.

Leptin inhibits directly glucocorticoid secretion by normal human and rat adrenal gland.

Different interactions have been described between glucocorticoids and the product of the ob gene leptin. Leptin can inhibit the activation of the hypothalamo-pituitary-adrenal axis by stressful stimuli, whereas adrenal glucocorticoids stimulate leptin production by the adipocyte. The present study was designed to investigate the potential direct effects of leptin to modulate glucocorticoid production by the adrenal. Human adrenal glands from kidney transplant donors were dissociated, and isolated primary cells were studied in vitro. These cells were preincubated with recombinant leptin (10(-10)-10(-7) M) for 6 or 24 h, and basal or ACTH-stimulated cortisol secretion was subsequently measured. Basal cortisol secretion was unaffected by leptin, but a significant and dose-dependent inhibition of ACTH-stimulated cortisol secretion was observed [down by 29 +/- 0.1% of controls with the highest leptin dose, P &lt; 0.01 vs. CT (unrelated positive control)]. This effect of leptin was also observed in rat primary adrenocortical cells, where leptin inhibited stimulated corticosterone secretion in a dose-dependent manner (down by 46 +/- 0.1% of controls with the highest leptin dose, P &lt; 0.001 vs. CT). These effects of leptin in adrenal cells are likely mediated by the long isoform of the leptin receptor (OB-R), because its transcript was found to be expressed in the adrenal tissue and leptin had no inhibitory effect in adrenal glands obtained from db/db mice. Therefore, leptin inhibits directly stimulated cortisol secretion from human and rat adrenal glands, and this may represent an important mechanism to modulate glucocorticoid levels in various metabolic states.

Test-retest repeatability of the pupil light response to blue and red light stimuli in normal human eyes using a novel pupillometer.

In this study, we evaluated the repeatability of pupil responses to colored light stimuli in healthy subjects using a prototype chromatic pupillometer. One eye of 10 healthy subjects was tested twice in the same day using monochromatic light exposure at two selected wavelengths (660 and 470 nm, intensity 300 cd/m(2)) presented continuously for 20 s. Pupil responses were recorded in real-time before, during, and after light exposure. Maximal contraction amplitude and sustained contraction amplitude were calculated. In addition, we quantified the summed pupil response during continuous light stimulation as the total area between a reference line representing baseline pupil size and the line representing actual pupil size over 20 s (area under the curve). There was no significant difference in the repeated measure compared to the first test for any of the pupil response parameters. In conclusion, we have developed a novel prototype of color pupillometer which demonstrates good repeatability in evoking and recording the pupillary response to a bright blue and red light stimulus.

Age-related changes of the multidrug resistance P-glycoprotein function in normal human peripheral blood T lymphocytes

The multidrug resistance P-glycoprotein is a transmembrane efflux pump expressed by lymphocytes and is involved in their cytolytic activity. In the present study, we investigated the age-related changes of P-glycoprotein function in normal peripheral blood lymphocytes. Blood samples from 90 normal volunteers (age range, 0 to 86 years) were analyzed. P-glycoprotein function was assessed by the flow cytometric rhodamine 123 assay. P-glycoprotein function was highest in cord blood and progressively declined with age in peripheral blood T CD4+ and CD8+ cells. In contrast, P-glycoprotein function did not vary with age in CD19+ B or CD16+CD56+ natural killer cells. These data suggest that the decline in P-glycoprotein function in T CD4+ and CD8+ lymphocytes as a function of age may contribute to the decrease in T cell cytolytic activity with aging.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Tamoxifen down-regulates CaMKII messenger RNA levels in normal human breast tissue

Tamoxifen was proven to reduce the incidence of breast cancer by 49% in women at increased risk of the disease in the Breast Cancer Prevention Trial. In order to identify potential candidates to explain the preventive effect induced by tamoxifen on breast cancer, normal breast tissue obtained from 42 fibroadenoma patients, randomly assigned to receive placebo or tamoxifen, was analyzed by the reverse Northern blot and RT-PCR techniques. The cDNA fragments used on Northern blot membranes were generated by the Human Cancer Genome Project funded by the Ludwig Institute for Cancer Research and FAPESP (Fundação de Amparo à Pesquisa do Estado de São Paulo, Brazil). Total RNA was obtained from normal breast tissue from patients with clinical, cytological and ultrasound diagnosis of fibroadenoma. After a 50-day treatment with tamoxifen (10 or 20 mg/day) or placebo, normal breast tissue adjacent to the tumor was collected during lumpectomy with local anesthesia. One differentially expressed gene, Calcium/calmodulin-dependent protein kinase II (CaMKII), was found to be down-regulated during TAM treatment. CaMKII is an ubiquitous serine/threonine protein kinase that has been implicated in the diverse effects of hormones utilizing Ca2+ as a second messenger as well as in c-fos activation. These results indicate that the down-regulation of CaMKII induced by TAM might represent alternative or additional mechanisms of the action of this drug on cell cycle control and response to hormones in normal human breast tissue.

68Ga-DOTATOC PET/CT and somatostatin receptor (sst1-sst5) expression in normal human tissue: correlation of sst2 mRNA and SUVmax

By targeting somatostatin receptors (sst) radiopeptides have been established for both diagnosis and therapy. For physiologically normal human tissues the study provides a normative database of maximum standardized uptake value (SUV(max)) and sst mRNA.

The cytochrome P450 aromatase lacking exon 5 is associated with a phenotype of nonclassic aromatase deficiency and is also present in normal human steroidogenic tissues

OBJECTIVE: The previously described c655G>A mutation of the human cytochrome P450 aromatase gene (P450aro, CYP19) results in aberrant splicing due to disruption of a donor splice site. To explain the phenotype of partial aromatase deficiency observed in a female patient described with this mutation, molecular consequences of the c655G>A mutation were investigated. DESIGN: To investigate whether the c655G>A mutation causes an aberrant spliced mRNA lacking exon 5 (-Ex5), P450aro RNA was analysed from the patient's lymphocytes by reverse transcription polymerase chain reaction (RT-PCR) and by splicing assays performed in Y1 cells transfected with a P450aro -Ex5 expression vector. Aromatase activity of the c655G>A mutant was predicted by three dimensional (3D) protein modelling studies and analysed in transiently transfected Y1 cells. Exon 5 might be predicted as a poorly defined exon suggesting a susceptibility to both splicing mutations and physiological alternative splicing events. Therefore, expression of the -Ex5 mRNA was also assessed as a possibly naturally occurring alternative splicing transcript in normal human steroidogenic tissues. PATIENTS: An aromatase deficient girl was born with ambiguous genitalia. Elevated serum LH, FSH and androgens, as well as cystic ovaries, were found during prepuberty. At the age of 8.4 years, spontaneous breast development and a 194.6 pmol/l serum oestradiol level was observed. RESULTS: The -Ex5 mRNA was found in lymphocytes of the P450aro deficient girl and her father, who was a carrier of the mutation. Mutant minigene expression resulted in complete exon 5 skipping. As expected from 3D protein modelling, -Ex5 cDNA expression in Y1 cells resulted in loss of P450aro activity. In addition, the -Ex5 mRNA was present in placenta, prepubertal testis and adrenal tissues. CONCLUSIONS: Alternative splicing of exon 5 of the CYP19 gene occurs in the wild type (WT) as well as in the c655G>A mutant. We speculate that for the WT it might function as a regulatory mechanism for aromatization, whereas for the mutant a relative prevalence of the shorter over the full-length protein might explain the phenotype of partial aromatase deficiency.