Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Fas ligand elicits a caspase-independent proinflammatory response in human keratinocytes: implications for dermatitis.

Fas ligand (FasL) causes apoptosis of epidermal keratinocytes and triggers the appearance of spongiosis in eczematous dermatitis. We demonstrate here that FasL also aggravates inflammation by triggering the expression of proinflammatory cytokines, chemokines, and adhesion molecules in keratinocytes. In HaCaT cells and in reconstructed human epidermis (RHE), FasL triggered a NF-kappaB-dependent mRNA accumulation of inflammatory cytokines (tumor necrosis factor-alpha, IL-6, and IL-1beta), chemokines (CCL2/MCP-1, CXCL1/GROalpha, CXCL3/GROgamma, and CXCL8/IL-8), and the adhesion molecule ICAM-1. Oligomerization of Fas was required both for apoptosis and for gene expression. Inhibition of caspase activity abolished FasL-dependent apoptosis; however, it failed to suppress the expression of FasL-induced genes. Additionally, in the presence of caspase inhibitors, but not in their absence, FasL triggered the accumulation of CCL5/RANTES (regulated on activation normal T cell expressed and secreted) mRNA. Our findings identify a novel proinflammatory role of FasL in keratinocytes that is independent of caspase activity and is separable from apoptosis. Thus, in addition to causing spongiosis, FasL may play a direct role in triggering and/or sustaining inflammation in eczemas.

Nuclear localization of HBD-1 in human keratinocytes.

OBJECTIVE: Human defensins and cathelicidins are a family of cationic antimicrobial peptides (AMPs), which play multiple roles in both innate and adaptive immune systems. They have direct antimicrobial activity against several microorganisms including burn pathogens. The majority of components of innate and adaptive immunity either express naturally occurring defensins or are otherwise chemoattracted or functionally affected by them. They also enhance adaptive immunity and wound healing and alter antibody production. All mechanisms to explain multiple functions of AMPs are not clearly understood. Prior studies to localize defensins in normal and burned skin using deconvolution fluorescence scanning microscopy indicate localization of defensins in the nucleus, perinuclear regions, and cytoplasm. The objective of this study is to further confirm the identification of HBD-1 in the nucleus by deconvolution microscopic studies involving image reconstruction and wire frame modeling. RESULTS: Our study demonstrated the presence of intranuclear HBD-1 in keratinocytes throughout the stratum spinosum by costaining with the nuclear probe DAPI. In addition, HBD-1 sequence does show some homology with known cationic nuclear localization signal sequences. CONCLUSION: To our knowledge, this is the first report to localize HBD-1 in the nuclear region, suggesting a role for this peptide in gene expression and providing new data that may help determine mechanisms of defensin functions.

Regulation of Bcl-xL expression in human keratinocytes by cell–substratum adhesion and the epidermal growth factor receptor

Cell–substratum adhesion is an essential requirement for survival of human neonatal keratinocytes in vitro. Similarly, activation of the epidermal growth factor receptor (EGF-R) has recently been implicated not only in cell cycle progression but also in survival of normal keratinocytes. The mechanisms by which either cell–substratum adhesion or EGF-R activation protect keratinocytes from programmed cell death are poorly understood. Here we describe that blockade of the EGF-R and inhibition of substratum adhesion share a common downstream event, the down-regulation of the cell death protector Bcl-xL. Expression of Bcl-xL protein was down-regulated during forced suspension culture of keratinocytes, concurrent with large-scale apoptosis. Similarly, EGF-R blockade was accompanied by down-regulation of Bcl-xL steady-state mRNA and protein levels to an extent comparable to that observed in forced suspension culture. However, down-regulation of Bcl-xL expression by EGF-R blockade was not accompanied by apoptosis; in this case, a second signal, generated by passaging, was required to induce rapid and large-scale apoptosis. These findings are consistent with the conclusions that (i) Bcl-xL represents a shared molecular target for signaling through cell-substrate adhesion receptors and the EGF-R, and (ii) reduced levels of Bcl-xL expression through EGF-R blockade lower the tolerance of keratinocytes for cell death signals generated by cellular stress.

Matrix-independent Survival of Human Keratinocytes through an EGF Receptor/MAPK-Kinase-dependent Pathway

Normal epithelial cells undergo apoptosis when they are denied contact with the extracellular matrix, in a process termed “anoikis.” Conversely, malignant epithelial cells typically acquire anchorage independence, i.e., the capacity to survive and grow in the absence of matrix interaction. Here we asked the question whether anoikis is affected by signaling through the EGF receptor (EGFR). We focused on the EGFR because EGFR signaling is frequently deregulated in malignant epithelial cells. We demonstrate that EGFR activation markedly alleviated the requirement of matrix engagement for survival of primary and immortalized human keratinocytes in suspension culture. Protection of epithelial cells through EGFR activation against anoikis was associated with and required sustained MAPK phosphorylation during the early phase of suspension culture. Interestingly, high levels of MAPK phosphorylation were not only required for EGFR-mediated protection against anoikis but also occurred as a consequence of caspase activation at later stages of suspension culture. These results demonstrate that EGFR activation contributes to anchorage-independent epithelial cell survival and identify MAPK activation as an important mechanism in this process.

Normal human serum contains a natural IgM antibody cytotoxic for human neuroblastoma cells.

Neuroblastoma (NB) is characterized by the second highest spontaneous regression of any human malignant disorder, a phenomenon that remains to be elucidated. In this study, a survey of 94 normal human adult sera revealed a considerable natural humoral cytotoxicity against human NB cell lines in approximately one-third of the tested sera of both genders. Specific cell killing by these sera was in the range of 40% to 95%. Serum cytotoxicity was dependent on an intact classical pathway of complement. By several lines of evidence, IgM antibodies were identified as the cytotoxic factor in the sera. Further analyses revealed that a 260-kDa protein was recognized by natural IgM of cytotoxic sera in Western blots of NB cell extracts. The antigen was expressed on the surface of seven human NB cell lines but not on human melanoma or other control tumor cell lines derived from kidney, pancreas, colon, bone, skeletal muscle, lymphatic system, and bone marrow. Furthermore, no reactivity was observed with normal human fibroblasts, melanocytes, and epidermal keratinocytes. The antigen was expressed in vivo as detected by immunohistochemistry in both the tumor of a NB patient and NB tumors established in nude rats from human NB cell lines. Most interestingly, the IgM anti-NB antibody was absent from the sera of 11 human NB patients with active disease. The anti-NB IgM also could not be detected in tumor tissue obtained from a NB patient. Collectively, our data suggest the existence of a natural humoral immunological tumor defense mechanism, which could account for the in vivo phenomenon of spontaneous NB tumor regression.

Quercetin inhibits UV irradiation-induced inflammatory cytokine production in primary human keratinocytes by suppressing NF-kappa B pathway

Background: Topical flavonoids, such as quercetin, have been shown to reduce ultraviolet (UV) irradiation-mediated skin damage. However, the mechanisms and signaling pathways involved in this protective effect are not clear. UV irradiation leads to activation of two major signaling pathways, namely nuclear factor kappa B (NF-kappa B) and activator protein-1 (AP-1) pathways. Activation of NF-kappa B pathway by UV irradiation stimulates inflammatory cytokine expression, whereas activation of AP-1 pathway by UV irradiation promotes matrix metalloproteinase (MMP) production. Both pathways contribute to UV irradiation-induced skin damage, such as photoaging and skin tumor formation. Objective: To elucidate the underlying mechanism, we examined the effect of quercetin on UV irradiation induced activation of NF-kappa B and AP-1 pathways. Methods: Primary human keratinocytes, the major skin cell type subjected to physiological solar UV irradiation, were used to study the effects of quercetin on UV irradiation-induced signal transduction pathways. Results: Quercetin decreased UV irradiation-induced NF-kappa B DNA-binding by 80%. Consequently, quercetin suppressed UV irradiation-induced expression of inflammatory cytokines IL-1 beta (similar to 60%), IL-6 (similar to 80%), IL-8 (similar to 76%) and TNF-alpha (similar to 69%). In contrast, quercetin had no effect on UV irradiation activation of three MAP kinases, ERK, JNK, or p38. Accordingly, induction of AP-1 target genes such as MMP-1 and MMP-3 by UV irradiation was not suppressed by quercetin. Conclusion: Our data indicate that the ability of quercetin to block UV irradiation-induced skin inflammation is mediated, at least in part, by its inhibitory effect on NF-kappa B activation and inflammatory cytokine production. (C) 2011 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

The ratio of messenger RNA levels of receptor activator of nuclear factor kappa B ligand to osteoprotegerin correlates with bone remodeling indices in normal human cancellous bone but not in osteoarthritis

skeletal disease. Bone remodeling is initiated by osteoclastic resorption followed by osteoblastic formation of new bone. Receptor activator of nuclear factor KB ligand (RANKL) is a newly described regulator of osteoclast formation and function, the activity of which appears to be a balance between interaction with its receptor RANK and with an antagonist binding protein osteoprotegerin (OPG). Therefore, we have examined the relationship between the expression of RANKL, RANK, and OPG and indices of bone structure and turnover in human cancellous bone from the proximal femur. Bone samples were obtained from individuals with osteoarthritis (OA) at joint replacement surgery and from autopsy controls. Histomorphometric analysis of these samples showed that eroded surface (ES/BS) and osteoid surface (OS/BS) were positively associated in both control (p < 0.001) and OA (p < 0.02), indicating that the processes of bone resorption and bone formation remain coupled in OA, as they are in controls. RANKL, OPG, and RANK messenger RNA, (mRNA) were abundant in human cancellous bone, with significant differences between control and OA individuals. In coplotting the molecular and histomorphometric data, strong associations were found between the ratio of RANKL/OPG mRNA and the indices of bone turnover (RANKL/OPG vs. ES/BS: r = 0.93, p < 0.001; RANKL/OPG vs. OS/BS: r = 0.80, p < 0.001). These relationships were not evident in trabecular bone from severe OA, suggesting that bone turnover may be regulated differently in this disease. We propose that the effective concentration of RANKL is related causally to bone turnover.

A soluble form of CD83 is released from activated dendritic cells and B lymphocytes, and is detectable in normal human sera

CD83 is an inducible glycoprotein expressed predominantly by dendritic cells (DC) and B lymphocytes. Expression of membrane CD83 (mCD83) is widely used as a marker of differentiated/ activated DC but its function and ligand(s) are presently unknown. We report the existence of a soluble form of CD83 (sCD83). Using both a sCD83-specific ELISA and Western blotting, we could demonstrate the release of sCD83 by mCD83(+) B cell and Hodgkin's disease-derived cell lines, but not mCD83(-) cells. Inhibition of de novo protein synthesis did not affect the release of sCD83 during short-term (2 h) culture of cell lines although mCD83 expression was significantly reduced, suggesting sCD83 is generated by the release of mCD83. Isolated tonsillar B lymphocytes and monocyte-derived DC, which are mCD83(low), released only low levels of sCD83 during culture. However, the differentiation/activation of these populations both up-regulated mCD83 and increased sCD83 release significantly. Analysis of sera from normal donors demonstrated the presence of low levels (121 +/- 3.6 pg/ml) of circulating sCD83. Further studies utilizing purified sCD83 and the analysis of sCD83 levels in disease may provide clues to the function and ligand(s) of CD83.

Placental growth hormone is not suppressed by oral glucose loading in normal human pregnancy

Placental growth hormone (PGH) progressively replaces pituitary growth hormone in the maternal circulation from mid-gestation onwards in human pregnancy. Our previous investigations have shown that placental growth hormone concentrations correlate well with foetal growth. Despite the apparent correlation between PGH and birthweight, the physiology of its secretion during pregnancy has not been well defined. We investigated the response of maternal serum PCH to oral glucose loading in pregnant women (n = 24) who demonstrated normal glucose tolerance at a mean gestation of 29 weeks. Mean (SEM) fasting PGH concentrations were high (36.9 [6.4] ng/ml). No suppression of PGH was noted at one, two or three hours after a 75 g oral glucose load. Similarly, no changes were noted in growth hormone binding protein or in calculated free PGH over the course of the glucose tolerance test. As expected, insulin concentrations rose sixfold and insulin like growth factor binding protein 1 concentrations fell by 20% with glucose loading. Cot-relation analysis showed maternal weight, BMI, fasting serum glucose serum insulin to be significantly correlated with the babies' birthweight. Our results support the proposition that PGH concentrations in maternal serum are not Suppressed by oral glucose loading in non-diabetic mothers.

Production of TNF-a by primary cultures of human keratinocytes challenged with Loxosceles gaucho venom

Primary cultures of human keratinocytes were challenged with increasing doses from 10 ng/mL to 2 mg/mL of Loxosceles gaucho venom, responsible for dermonecrotic lesion in humans. TNF-a was investigated by bioassay and ELISA in the supernatant of the cultures challenged with 100 ng/mL, 500 ng/mL, 1 and 2 mg/mL of venom. TNF-a was detected by bioassay in the supernatant of cultures challenged with 100 ng/mL, after 6 h. The cytokine was detected by ELISA in the supernatant of the cells challenged with doses of l mg/mL, after 6 and 12 h. The results point out the capacity of this venom to activate the keratinocytes in primary cultures to produce TNF-a. The production of cytokines could contribute to the local inflammatory process in patients bitten by Loxosceles sp.

Molecular analysis of death receptors mediated apoptotic and non-apoptotic signalling pathways in human keratinocytes

Magdeburg, Univ., Fak. für Naturwiss., Diss., 2011

Characterization and detection of naturally occurring antibodies against IL-1 alpha and IL-1 beta in normal human plasma.

During the development and testing of a radioreceptor assay (RRA) for human IL-1, we have detected and identified the presence of auto-antibodies to IL-1 in normal human plasma (NHP). The RRA is based on the competition between human 125I-labeled rIL-1 alpha and standard or unknown quantities of IL-1 alpha or IL-1 beta for binding to a limited amounts of IL-1 receptor (IL-1R) isolated from the EL4 mouse thymoma cell line. NHP from 20 out of 100 unselected blood donors were found to completely inhibit the binding of 125I-labeled IL-1 alpha to its receptor, suggesting the presence in these NHP samples of either abnormal amounts of IL-1 or of a factor binding to the 125I-labeled IL-1 alpha. Special care was taken to ascertain that the inhibitory factors were antibodies and not soluble IL-1 receptor antagonist. When plasma samples with inhibiting activity were incubated with labeled IL-1 alpha and chromatographed on a Sephadex G200 column, they were found to contain 125I-labeled complexes with an apparent molecular weight of 150-200kD. The IL-1 binding factor could be eliminated from plasma by incubation with protein A-Sepharose, suggesting that it consisted in IgG antibodies directed against IL-1. Furthermore, the antibody nature of the inhibiting factor was confirmed by its binding to purified rIL-1 coupled to Sepharose. Screening of 200 NHP samples by incubation with 100 pg of 125I-labeled IL-1 followed by precipitation with 12% of polyethylene glycol (PEG) confirmed that about 25% of NHP contain detectable IgG antibodies to IL-1 alpha, while only 2% of NHP contain antibodies to IL-1 beta. No correlation between the presence of these anti-IL-1 antibodies and any particular major histocompatibility complex or any pathological conditions was detected. We suggest that all serum samples assayed for IL-1 alpha or IL-1 beta content should be pretested with the PEG precipitation assay described here.

Immunohistochemical expression of endothelial markers CD31, CD34, von Willebrand Factor and Fli-1 in normal human tissues

Résumé du travail de thèse Introduction : Les différentes cellules endothéliales du lit vasculaire ont de nombreuses similitudes fonctionnelles et morphologiques. Cependant, elles présentent également une importante hétérogénéité structurelle et fonctionnelle qui peut avoir des implications notamment dans l'angiogenèse et le développement des maladies cardio-vasculaires. Peu d'études ont été publiées au sujet de l'expression et de la distribution des marqueurs endothéliaux dans les tissus humain normaux. Objectif : Nous avons étudié l'expression immunohistochimique des marqueurs endothéliaux CD31, CD34, vWF et Fli-1 dans les vaisseaux périphériques du rein, du poumon, de la rate, du foie, du cour et des gros vaisseaux ; incluant l'aorte, la veine cave inférieure, l'artère rénale ainsi que les artères et veines pulmonaires et fémorales. Matériel et méthodes : Les échantillons tissulaires ont été obtenus à partir de matériel d'autopsie et de biopsies. Le matériel a été fixé en formaline et inclus en paraffine. Les coupes de paraffine ont été colorées immunohistochimiquement avec CD31, CD34 et vWF. Les biopsies ont également été colorées immunohistochimiquement avec Fli-1, D2-40 et Lyve-1. Résultats : L'expression immunohistochimique de ces marqueurs est hétérogène dans les différents organes étudiés. Dans le rein, l'endothélium fenêtré des glomérules exprime fortement CD31 et CD34. Par contre, il n'exprime pas ou alors de manière faible et focale vWF. Dans le poumon, les capillaires alvéolaires expriment fortement CD31 et CD34 mais sont habituellement négatifs pour le vWF. L'expression de vWF augmente graduellement avec le calibre vasculaire dans le poumon. Les sinusoïdes de la rate expriment CD31 de manière diffuse mais ils n'expriment pas CD34. Les sinusoïdes du foie expriment CD31 de part et d'autre des lobules. Par contre, CD34 est exprimé seulement dans la région périportale. L'expression de Fli-1 dans les cellules endothéliales est ubiquitaire et ne varie pas suivant le type de vaisseau ou d'organe. Fli-1 est également exprimé dans d'autres types de cellules, essentiellement des lymphocytes. D2-40 est exprimé seulement dans l'endothélium des vaisseaux lymphatiques. L'expression de Lyve-1 dans ce matériel de routine était inconstante et non reproductible. Conclusion : Ces résultats indiquent que l'expression des marqueurs endothéliaux CD31, CD34 et vWF est hétérogène dans le lit vasculaire et qu'elle varie entre différents vaisseaux et différents compartiments anatomiques du même organe. D2-40 ne marque que les cellules endothéliales lymphatiques.

Isolation and characterization of carcinoembryonic antigen (CEA) extracted from normal human colon mucosa.

Carcinoembryonic antigen (CEA) was identified in perchloric acid (PCA)_extract from normal colon mucosa by 2 immunological criteria: a line of identity in double diffusion and a parallel inhibition curve in radioimmunoassay (RIA), both with reference colon carcinoma-CEA (CEA-Tu). The average concentration of CEA in normal colon mucosa (CEA-No) was 35 times lower than in primary large bowel carcinomas and 230 times lower than in metastatic colon or rectum carcinomas. CEA-No was purified from PCA extracts of normal colon mucosa by Sephadex G-200 filtration and immunoadsorbent columns. Purified CEA-No had quatitatively the same inhibition activity in RIA as the British Standard CEA coded 73/601. Purified CEA-No was labelled with 125I. The percentage of binding of labelled CEA-No to a specific goat anti-CEA-Tu antiserum was similar to that of CEA-Tu. Labelled CEA-No could be used as radioactive tracer in RIA as well as labelled CEA-Tu. The physico-chemical properties of purified CEA-Tu as demonstrated by Sepharose 6 B filtration, SDS Polyacrylamide gel analysis and cesium chloride density gradient, were found to be almost identical to those of reference CEA-Tu. Preliminary results showed that CEA-No and CEA-Tu contained the same types of carbohydrates in similar proportions. A rabbit antiserum against CEA-No was obtained which demonstrated the same specificity as conventional anti-CEA-Tu antisera.