Mutation screening of the c-MYB negative regulatory domain in acute and chronic myeloid leukaemia

Over-expression of the c-myb gene and expression of activated forms of myb are known to transform haemopoietic cells, particularly cells of the myeloid lineage. Truncations or mutations that disrupt the negative regulatory domain (NRD) of the Myb protein confer an increased ability to transform cells. Although it has proved difficult to link mutations in c-MYB to human leukaemia, no studies investigating the presence of mutations within the c-MYB NRD have been reported. Therefore, we have performed mutational analysis of this region, using polymerase chain reaction-single-stranded conformation polymorphism and sequence analysis, in 26 patients with acute or chronic myeloid leukaemia, No mutations were detected, indicating that mutation of this region of the Myb protein is not common in the pathogenesis or progression of these diseases.

Modulation of c-Myb-induced transcription activation by a phosphorylation site near the negative regulatory domain.

The c-myb protooncogene encodes a highly conserved transcription factor that functions as both an activator and a repressor of transcription. The v-myb oncogenes of E26 leukemia virus and avian myeloblastosis virus encode proteins that are truncated at both the amino and the carboxyl terminus, deleting portions of the c-Myb DNA-binding and negative regulatory domains. This has led to speculation that the deleted regions contain important regulatory sequences. We previously reported that the 42-kDa mitogen-activated protein kinase (p42mapk) phosphorylates chicken and murine c-Myb at multiple sites in the negative regulatory domain in vitro, suggesting that phosphorylation might provide a mechanism to regulate c-Myb function. We now report that three tryptic phosphopeptides derived from in vitro phosphorylated c-Myb comigrate with three tryptic phosphopeptides derived from metabolically labeled c-Myb immunoprecipitated from murine erythroleukemia cells. At least two of these peptides are phosphorylated on serine-528. Replacement of serine-528 with alanine results in a 2- to 7-fold increase in the ability of c-Myb to transactivate a Myb-responsive promoter/reporter gene construct. These findings suggest that phosphorylation serves to regulate c-Myb activity and that loss of this phosphorylation site from the v-Myb proteins may contribute to their transforming potential.

Rapid and efficient fusion of phospholipid vesicles by the α-helical core of a SNARE complex in the absence of an N-terminal regulatory domain

A protease-resistant core domain of the neuronal SNARE complex consists of an α-helical bundle similar to the proposed fusogenic core of viral fusion proteins [Skehel, J. J. & Wiley, D. C. (1998) Cell 95, 871–874]. We find that the isolated core of a SNARE complex efficiently fuses artificial bilayers and does so faster than full length SNAREs. Unexpectedly, a dramatic increase in speed results from removal of the N-terminal domain of the t-SNARE syntaxin, which does not affect the rate of assembly of v-t SNARES. In the absence of this negative regulatory domain, the half-time for fusion of an entire population of lipid vesicles by isolated SNARE cores (≈10 min) is compatible with the kinetics of fusion in many cell types.

Identification of an additional negative regulatory region for p53 sequence-specific DNA binding

The DNA binding activity of p53 is crucial for its tumor suppressor function and is subject to tight regulation. Previous studies revealed that the inhibitory function of the p53 C terminus is implicated in the latent, low affinity sequence-specific DNA binding activity of p53 in the uninduced state. Sequence-specific DNA binding of p53 has been shown to be activated by several posttranslational modifications and interacting proteins that target predominantly the C terminus. Moreover, several authors have shown that synthetic peptides corresponding to p53 C-terminal sequences activate p53 sequence-specific DNA binding. In an effort to identify the interaction site of p53 with these activating peptides we assessed complex formation between p53 deletion constructs and C-terminal activating peptides by peptide affinity precipitation. This study revealed that two distal regions of the p53 molecule contribute synergistically to the interaction with activating C-terminal peptides: amino acids 80–93 and 364–393. The C-terminal residues 364–393 are already well characterized as having negative regulatory function. DNA binding analyses with these deletion constructs reveal a comparable negative regulatory activity for residues 80–93, defining this region as a previously unidentified negative regulatory domain of p53. Furthermore, synthetic peptides spanning this newly identified proline-rich negative regulatory region (residues 80–93) are able to activate p53 sequence-specific DNA binding in vitro. We suggest that both negative regulatory regions, residues 80–93 and 364–393, contribute cooperatively to the maintenance of the latent, low-affinity DNA binding conformation of p53.

The sulfur controller-2 negative regulatory gene of Neurospora crassa encodes a protein with beta-transducin repeats.

The sulfur regulatory system of Neurospora crassa is composed of a set of structural genes involved in sulfur catabolism controlled by a genetically defined set of trans-acting regulatory genes. These sulfur regulatory genes include cys-3+, which encodes a basic region-leucine zipper transcriptional activator, and the negative regulatory gene scon-2+. We report here that the scon-2+ gene encodes a polypeptide of 650 amino acids belonging to the expanding beta-transducin family of eukaryotic regulatory proteins. Specifically, SCON2 protein contains six repeated G beta-homologous domains spanning the C-terminal half of the protein. SCON2 represents the initial filamentous fungal protein identified in the beta-transducin group. Additionally, SCON2 exhibits a specific amino-terminal domain that potentially defines another subfamily of beta-transducin homologs. Expression of the scon-2+ gene has been examined using RNA hybridization and gel mobility-shift analysis. The dependence of scon-2+ expression on CYS3 function and the binding of CYS3 to the scon-2+ promoter indicate the presence of an important control loop within the N. crassa sulfur regulatory circuit involving CYS3 activation of scon-2+ expression. On the basis of the presence of beta-transducin repeats, the crucial role of SCON2 in the signal-response pathway triggered by sulfur limitation may be mediated by protein-protein interactions.

Characterization of an upstream negative regulatory region of the mouse {\it neu\/} promoter

Cloning and characterization of the mouse neu gene revealed the presence of positive and negative cis-acting regulatory elements in the mouse neu promoter. An upstream region located between the SmaI and SphI sites of the promoter appeared to contribute significantly to negative regulation of the mouse neu gene, since deletion of this region led to a marked increase in transcriptional activity. To further characterize the mouse neu promoter I conducted a more exhaustive study on this cis-acting region which had not previously been studied in either human or rat neu promoters.^ The SmaI-SphI region was paced in front of the minimal thymidine kinase promoter where it inhibited transcription in both NIH3T3 and Hela cells. Physical association of nuclear proteins with this region was confirmed by electro-mobility shift assays. Four specific protein-DNA complexes were detected which involved interaction of proteins with various portions of the SmaI-SphI region. The most dominant protein complexes could be competed by SmaI-NruI and PstI-SphI subregions. Subsequent gel-shifts using SmaI-NruI and PstI-SphI as probes further confirmed the requirement of these two regions for the formation of the three fastest migrating complexes. Methylation interference and DNase I footprinting analyses were performed to determine the specific DNA sequences required for protein interaction. The two sequences identified were a 28 bp sequence, GAGCTTTCTTGGCTTAGTTCCAGACTCA, from the SmaI-NruI region (SN element) and a 23 bp sequence, AGGGACACCTTTGATCTGACCTTTA, from the PstI-SphI fragment (PS element). The PS and SN elements identified by footprinting were used as probes in gel-shift assays. Both oligonucleotides were capable of forming specific complexes with nuclear proteins. Sequence analysis of the SmaI-SphI region indicated that another sequence similar to PS element was located 330 bp upstream of the PS element. The identified SN and PS elements were subcloned into pMNSphICAT and transfected into NIH3T3 cells. Measurement of CAT activity indicated that both elements were sufficient to inhibit transcription from the mouse neu promoter. Both elements appeared to mediate binding in all cell types examined. Thus, I have identified two silencer elements from an upstream region of the mouse neu promoter which appear to regulate transcription in various cell lines. ^

Mutagenesis of the regulatory domain of phenylalanine hydroxylase

The regulatory domain of phenylalanine hydroxylase (PAH, EC 1.14.16.1) consists of more than 100 amino acids at the N terminus, the removal of which significantly activates the enzyme. To study the regulatory properties controlled by the N terminus, a series of truncations and site-specific mutations were made in this region of rat PAH. These enzymes were expressed highly in Escherichia coli and purified through a pterin-conjugated Sepharose affinity column. The removal of the first 26 amino acids of the N terminus increased the activity by about 20-fold, but removal of the first 15 amino acids increased the activity by only 2-fold. Replacing serine-29 of rat PAH with cysteine from the same site of human PAH increased the activity by more than 4-fold. Mutation of serine to other amino acids with varying side chains: alanine, methionine, leucine, aspartic acid, asparagine, and arginine also resulted in significant activation, indicating a serine-specific inhibitory effect. But these site-specific mutants showed 30–40% lower activity when assayed with 6-methyl-5,6,7,8-tetrahydropterin. Stimulation of hydroxylase activity by preincubation of the enzyme with phenylalanine was inversely proportional to the activation state of all these mutants. Combined with recent crystal structures of PAH [Kobe, B. et al. (1999) Nat. Struct. Biol. 6, 442–448; and Erlandsen, H., Bjorgo, E., Flatmark, T. & Stevens, R. C. (2000) Biochemistry 39, 2208–2217], these data suggest that residues 16–26 have a controlling regulatory effect on the activity by interaction with the dihydroxypropyl side chain of (6R)-5,6,7,8-tetrahydrobiopterin. The serine/cysteine switch explains the difference in regulatory properties between human and rat PAH. The N terminus as a whole is important for maintaining rat PAH in an optimum catalytic conformation.

Cloning of rat MEK kinase 1 cDNA reveals an endogenous membrane-associated 195-kDa protein with a large regulatory domain.

The coding sequence of rat MEK kinase 1 (MEKK1) has been determined from multiple, independent cDNA clones. The cDNA is full-length based on the presence of stop codons in all three reading frames of the 5' untranslated region. Probes from the 5' and the 3' coding sequences both hybridize to a 7-kb mRNA. The open reading frame is 4.5 kb and predicts a protein with molecular mass of 161,225 Da, which is twice the size of the previously published MEKK1 sequence and reveals 801 amino acids of novel coding sequence. The novel sequence contains two putative pH domains, two proline-rich regions, and a cysteine-rich region. Antisera to peptides derived from this new sequence recognize an endogenous protein in human and rodent cells of 195 kDa, consistent with the size of the expressed rat MEKK1 clone. Endogenous and recombinant rat MEKK1 are enriched in membranes; little of either is found in soluble fractions. Expression of recombinant rat MEKK1 leads to activation of three mitogen-activated protein kinase modules in the order c-Jun N-terminal kinase/stress-activated protein kinase > p38 mitogen-activated protein kinase = extracellular signal-regulated kinase 2.

Target sequence recognition by the calmodulin superfamily: implications from light chain binding to the regulatory domain of scallop myosin.

Some of the rules for how members of the calmodulin (CaM) superfamily bind to target peptides are revealed by the crystal structure of the regulatory domain of scallop myosin. The structure shows that the IQ motif of the heavy chain in this invertebrate myosin imposes constraints on both the positioning and conformation of the individual lobes of the light chains. In contrast, analysis of the contact residues in the targets bound by Ca(2+)-CaM reveals how the structure of CaM accommodates a broader range of sequences consonant with this protein's functional diversity.

A regulatory domain in the C-terminal extension of the yeast glycerol channel Fps1p

The Saccharomyces cerevisiae gene FPS1 encodes an aquaglyceroporin of the major intrinsic protein (MIP) family. The main function of Fps1p seems to be the efflux of glycerol in the adaptation of the yeast cell to lower external osmolarity. Fps1p is an atypical member of the family, because the protein is much larger (669 amino acids) than most MIPs due to long hydrophilic extensions in both termini. We have shown previously that a short domain in the N-terminal extension of the protein is required for restricting glycerol transport through the channel (Tamás, M. J., Karlgren, S., Bill, R. M., Hedfalk, K., Allegri, L., Ferreira, M., Thevelein, J. M., Rydström, J., Mullins, J. G. L., and Hohmann, S. (2003) J. Biol. Chem. 278, 6337-6345). Deletion of the N-terminal domain results in an unregulated channel, loss of glycerol, and osmosensitivity. In this work we have investigated the role of the Fps1p C terminus (139 amino acids). A set of eight truncations has been constructed and tested in vivo in a yeast fps1Δ strain. We have performed growth tests, membrane localization following cell fractionation, and glycerol accumulation measurements as well as an investigation of the osmotic stress response. Our results show that the C-terminal extension is also involved in restricting transport through Fps1p. We have identified a sequence of 12 amino acids, residues 535-546, close to the sixth transmembrane domain. This element seems to be important for controlling Fps1p function. Similar to the N-terminal domain, the C-terminal domain is amphiphilic and has a potential to dip into the membrane.

A short regulatory domain restricts glycerol transport through yeast Fps1p

The controlled export of solutes is crucial for cellular adaptation to hypotonic conditions. In the yeast Saccharomyces cerevisiae glycerol export is mediated by Fpslp, a member of the major intrinsic protein (MIP) family ]of channel proteins. Here we describe a short regulatory domain that restricts glycerol transport through Fpslp. This domain is required for retention of cellular glycerol under hypertonic stress and hence acquisition of osmotolerance. It is located in the N-terminal cytoplasmic extension close to the first transmembrane domain. Several residues within that domain and its precise position are critical for channel control while the proximal residues 13-215 of the N-terminal extension are not required. The sequence of the regulatory domain and its position are perfectly conserved in orthologs from other yeast species. The regulatory domain has an amphiphilic character, and structural predictions indicate that it could fold back into the membrane bilayer. Remarkably, this domain has structural similarity to the channel forming loops B and E of Fpslp and other glycerol facilitators. Intragenic second-site suppressor mutations of the sensitivity to high osmolarity conferred by truncation of the regulatory domain caused diminished glycerol transport, confirming that elevated channel activity is the cause of the osmosensitive phenotype.

Molecular cloning reveals that the p160 myb-binding protein is a novel, predominantly nucleolar protein which may play a role in transactivation by Myb

We have previously detected two related murine nuclear proteins, p160 and p67, that can bind to the leucine zipper motif within the negative regulatory domain of the Myb transcription factor. We now describe the molecular cloning of cDNA corresponding to murine p160. The P160 gene is located on mouse chromosome 11, and related sequences are found on chromosomes 1 and 12. The predicted p160 protein is novel, and in agreement with previous studies, we find that the corresponding 4.5-kb mRNA is ubiquitously expressed. We showed that p67 is an N-terminal fragment of p160 which is generated by proteolytic cleavage in certain cell types. The protein encoded by the cloned p160 cDNA and an engineered protein (p67*) comprising the amino-terminal region of p160 exhibit binding specificities for the Myb and Jun leucine zipper regions identical to those of endogenous p160 and p67, respectively. This implies that the Myb-binding site of p160 lies within the N-terminal 580 residues and that the Jun-binding site is C-terminal to this position. Moreover, we show that p67* but not p160 can inhibit transactivation by Myb. Unexpectedly, immunofluorescence studies show that p160 is localized predominantly in the nucleolus. The implications of these results for possible functions of p160 are discussed.

Molecular cloning and chromosomal mapping of the human homologue of MYB binding protein (P160) 1A (MYBBP1A) to 17p13.3

We have previously isolated and characterized murine MYB binding protein (p160) 1a, a protein that specifically interacts with the leucine zipper motif within the negative regulatory domain of the c-Myb proto-oncoprotein, We now describe the molecular cloning of the human MYBBP1A cDNA and chromosomal localization to 17p13.3 by fluorescence in situ hybridization analysis, Given the likely presence of a tumor suppressor gene (or genes) within this region of chromosome 17, the position of MYBBP1A was further mapped by radiation hybrid analysis and was found to lie between markers D17S1828 and D17S938. A P1 artificial chromosome clone containing the 5' region of MYBBP1A was isolated and indicates a physical linkage between MYBBP1A and the 15-lipoxygenase gene (ALOX15), A novel, polymorphic (CA)(25) dinucleotide repeat was also isolated from this PAC and may serve as a useful marker for MYBBP1A and this region of chromosome 17. (C) 1999 Academic Press.

A functional genetic screen identifies regions at the C-terminal tail and death-domain of death-associated protein kinase that are critical for its proapoptotic activity

Death-associated protein kinase (DAP-kinase) is a Ca+2/calmodulin-regulated serine/threonine kinase with a multidomain structure that participates in apoptosis induced by a variety of signals. To identify regions in this protein that are critical for its proapoptotic activity, we performed a genetic screen on the basis of functional selection of short DAP-kinase-derived fragments that could protect cells from apoptosis by acting in a dominant-negative manner. We expressed a library of randomly fragmented DAP-kinase cDNA in HeLa cells and treated these cells with IFN-γ to induce apoptosis. Functional cDNA fragments were recovered from cells that survived the selection, and those in the sense orientation were examined further in a secondary screen for their ability to protect cells from DAP-kinase-dependent tumor necrosis factor-α-induced apoptosis. We isolated four biologically active peptides that mapped to the ankyrin repeats, the “linker” region, the death domain, and the C-terminal tail of DAP-kinase. Molecular modeling of the complete death domain provided a structural basis for the function of the death-domain-derived fragment by suggesting that the protective fragment constitutes a distinct substructure. The last fragment, spanning the C-terminal serine-rich tail, defined a new regulatory region. Ectopic expression of the tail peptide (17 amino acids) inhibited the function of DAP-kinase, whereas removal of this region from the complete protein caused enhancement of the killing activity, indicating that the C-terminal tail normally plays a negative regulatory role. Altogether, this unbiased screen highlighted functionally important regions in the protein and revealed an additional level of regulation of DAP-kinase apoptotic function that does not affect the catalytic activity.