975 resultados para Modified Barrier function


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A new approach called the Modified Barrier Lagrangian Function (MBLF) to solve the Optimal Reactive Power Flow problem is presented. In this approach, the inequality constraints are treated by the Modified Barrier Function (MBF) method, which has a finite convergence property: i.e. the optimal solution in the MBF method can actually be in the bound of the feasible set. Hence, the inequality constraints can be precisely equal to zero. Another property of the MBF method is that the barrier parameter does not need to be driven to zero to attain the solution. Therefore, the conditioning of the involved Hessian matrix is greatly enhanced. In order to show this, a comparative analysis of the numeric conditioning of the Hessian matrix of the MBLF approach, by the decomposition in singular values, is carried out. The feasibility of the proposed approach is also demonstrated with comparative tests to Interior Point Method (IPM) using various IEEE test systems and two networks derived from Brazilian generation/transmission system. The results show that the MBLF method is computationally more attractive than the IPM in terms of speed, number of iterations and numerical conditioning. (C) 2011 Elsevier B.V. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In this paper is presented a new approach for optimal power flow problem. This approach is based on the modified barrier function and the primal-dual logarithmic barrier method. A Lagrangian function is associated with the modified problem. The first-order necessary conditions for optimality are fulfilled by Newton's method, and by updating the barrier terms. The effectiveness of the proposed approach has been examined by solving the Brazilian 53-bus, IEEE118-bus and IEEE162-bus systems.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This paper presents a new approach, predictor-corrector modified barrier approach (PCMBA), to minimize the active losses in power system planning studies. In the PCMBA, the inequality constraints are transformed into equalities by introducing positive auxiliary variables. which are perturbed by the barrier parameter, and treated by the modified barrier method. The first-order necessary conditions of the Lagrangian function are solved by predictor-corrector Newton`s method. The perturbation of the auxiliary variables results in an expansion of the feasible set of the original problem, reaching the limits of the inequality constraints. The feasibility of the proposed approach is demonstrated using various IEEE test systems and a realistic power system of 2256-bus corresponding to the Brazilian South-Southeastern interconnected system. The results show that the utilization of the predictor-corrector method with the pure modified barrier approach accelerates the convergence of the problem in terms of the number of iterations and computational time. (C) 2008 Elsevier B.V. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Optimization methods have been used in many areas of knowledge, such as Engineering, Statistics, Chemistry, among others, to solve optimization problems. In many cases it is not possible to use derivative methods, due to the characteristics of the problem to be solved and/or its constraints, for example if the involved functions are non-smooth and/or their derivatives are not know. To solve this type of problems a Java based API has been implemented, which includes only derivative-free optimization methods, and that can be used to solve both constrained and unconstrained problems. For solving constrained problems, the classic Penalty and Barrier functions were included in the API. In this paper a new approach to Penalty and Barrier functions, based on Fuzzy Logic, is proposed. Two penalty functions, that impose a progressive penalization to solutions that violate the constraints, are discussed. The implemented functions impose a low penalization when the violation of the constraints is low and a heavy penalty when the violation is high. Numerical results, obtained using twenty-eight test problems, comparing the proposed Fuzzy Logic based functions to six of the classic Penalty and Barrier functions are presented. Considering the achieved results, it can be concluded that the proposed penalty functions besides being very robust also have a very good performance.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Abstract: The increasingly high hygienic standards characterizing westernized societies correlate with an increasingly high prevalence of allergic disease. Initially based on these observations, the hygiene hypothesis postulates that reduced microbial stimulation during infancy impairs the immune system development and increases the risk of allergy. Moreover, there is increasing evidence that the crosstalk existing between the intestine and the resident microbiota is crucial for gut homeostasis. In particular, bacterial colonization of the gut affects the integrity of the gut barrier and stimulates the development of the gut associated immune tissue, both phenomena being essential for the immune system to mount a controlled response to food antigens. Therefore, alterations in the microbial colonization process, by compromising the barrier homeostasis, may increase the risk of food allergy. In this context, antibiotic treatment, frequently prescribed during infancy, affects gut colonization by bacteria. However, little is known about the impact of alterations in the colonization process on the maturation of the gut barrier and on the immunological response to oral antigens. The objective of this work was to determine the impact of a commercial antibiotic preparation employed in pediatric settings on the gut barrier status at the critical period of the suckling/weaning transition and to evaluate the physiological consequences of this treatment in terms of immune response to food antigens. We established an antibiotic-treated suckling rat model relevant to the pediatric population in terms of type, dose and route of administration of the antibiotic and of changes in the patterns of microbial colonization. Oral tolerance to a novel luminal antigen (ovalbumin) was impaired when the antigen was introduced during antibiotic treatment. These results paralleled to alterations in the intestinal permeability to macromolecules and reduced intestinal expression of genes coding for the major histocomptatibility complex II molecules, which suggest a reduced capacity of antigen handling and presentation in the intestine of the antibiotic-treated animals. In addition, low luminal IgA levels and reduced intestinal expression of genes coding for antimicrobial proteins suggest that protection against pathogens was reduced under antibiotic treatment. In conclusion, we observed in suckling rats that treatment with abroad-spectrum antibiotic commonly used in pediatric practices reduced the capacity of the immune system to develop tolerance. The impact of the antibiotic treatment on the immune response to the antigen-was likely mediated by the alterations of the gut microbiota, through impairment in the mechanisms of antigen handling and presentation. This work reinforces the body of data supporting a key role of the intestinal microbiota modulating the risk of allergy development and leads us to propose that the introduction of new food antigens should be avoided during antibiotic treatment in infants. Résumé: L'augmentation du niveau d'hygiène caractérisant les sociétés occidentales semble être fortement corrélée avec l'augmentation des cas d'allergie dans ces pays. De cette observation est née l'hypothèse qu'une diminution des stimuli microbiens pendant l'enfance modifie le développement du système immunitaire augmentant ainsi le risque d'allergie. En ce sens, un nombre croissant de données indiquent que les interactions existant entre l'intestin et les bactéries résidantes sont cruciales pour l'équilibre du système. En effet, la présence de bactéries dans l'intestin affecte l'intégrité de sa fonction de barrière et stimule le développement du système immunitaire intestinal. Ces deux paramètres étant essentiels à la mise en place d'une réponse contrôlée vis à vis d'un antigène reçu oralement, toute modification du processus naturel de colonisation compromettant l'équilibre intestinal pourrait augmenter le risque d'allergie. Les traitements aux antibiotiques, fréquemment prescrits en pédiatrie, modifient de façon conséquente le processus de colonisation bactérienne. Cependant peu de données existent concernant l'impact d'une altération du processus de colonisation sur la maturation de la barrière intestinale et de la réponse immunitaire dirigée contre un antigène. L'objectif de ce travail était de déterminer l'impact d'un antibiotique commercial et employé en pédiatrie sur l'état de la barrière intestinale au moment critique du sevrage et d'évaluer les conséquences physiologiques d'un tel traitement sur la réponse immune à un antigène alimentaire. Nous avons mis en place un modèle de rats allaités, traités à l'antibiotique, le plus proche possible des pratiques pédiatriques, en terme de nature, dose et voie d'administration de l'antibiotique. Nous avons constaté que l'établissement de la tolérance orale à un nouvel antigène (l'ovalbumine) est altéré quand celui-ci est donné pour la première fois au cours du traitement antibiotique. Ces résultats coïncident avec une diminution de la perméabilité intestinale aux macromolécules, ainsi qu'avec une diminution de l'expression des gènes codant pour les molécules du complexe majeur d'histocomptatibilité de classe II, suggérant une modification de l'apprêtement et de la présentation de l'antigène au niveau intestinal chez les rats traités à l'antibiotique. De plus, un faible taux d'IgA et une diminution de l'expression des gènes codant pour des protéines antimicrobiennes, observés après l'administration d'antibiotique, laissent à penser que la protection contre un pathogène est diminuée lors d'un traitement antibiotique. En conclusion, nous avons observé qu'un traitement antibiotique à large spectre d'activité, couramment utilisé en pédiatrie, réduit la capacité d'induction de la tolérance orale chez le rat allaité. L'impact du traitement antibiotique sur la réponse immune semble induite par l'altération de la flore intestinale via son effet sur les mécanismes d'apprêtement et de présentation de l'antigène. Ce travail renforce l'ensemble des données existantes qui accorde à la flore intestinale un rôle clef dans la modulation du risque de développement d'allergie et nous amène à recommander d'éviter l'introduction d'un nouvel aliment lorsqu'un enfant est traité aux antibiotiques.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Intravenous administration of polyclonal and monoclonal antibodies has proven to be a clinically valid approach in the treatment, or at least relief, of many acute and chronic pathologies, such as infection, immunodeficiency, and a broad range of autoimmune conditions. Plasma-derived IgG or recombinant IgG are most frequently used for intravenous or subcutaneous administration, whereas a few IgM-based products are available as well. We have established recently that secretory-like IgA and IgM can be produced upon association of plasma-derived polymeric IgA and IgM with a recombinant secretory component. As a next step toward potential future mucosal administration, we sought to unravel the mechanisms by which these secretory Igs protect epithelial cells located at the interface between the environment and the inside of the body. By using polarized epithelial Caco-2 cell monolayers and Shigella flexneri as a model enteropathogen, we found that polyspecific plasma-derived SIgA and SIgM fulfill many protective functions, including dose-dependent recognition of the antigen via formation of aggregated immune complexes, reduction of bacterial infectivity, maintenance of epithelial cell integrity, and inhibition of proinflammatory cytokine/chemokine production by epithelial cells. In this in vitro model devoid of other cellular or molecular interfering partners, IgM and secretory IgM showed stronger bacterial neutralization than secretory IgA. Together, these data suggest that mucosally delivered antibody preparations may be most effective when combining both secretory-like IgA and IgM, which, together, play a crucial role in preserving several levels of epithelial cell integrity.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The skin provides an efficient permeability barrier and protects from microbial invasion and oxidative stress. Here, we show that these essential functions are linked through the Nrf2 transcription factor. To test the hypothesis that activation of Nrf2 provides skin protection under stress conditions, we determined the consequences of pharmacological or genetic activation of Nrf2 in keratinocytes. Surprisingly, mice with enhanced Nrf2 activity in keratinocytes developed epidermal thickening, hyperkeratosis and inflammation resembling lamellar ichthyosis. This resulted from upregulation of the cornified envelope proteins small proline-rich proteins (Sprr) 2d and 2h and of secretory leukocyte peptidase inhibitor (Slpi), which we identified as novel Nrf2 targets in keratinocytes. Since Sprrs are potent scavengers of reactive oxygen species and since Slpi has antimicrobial activities, their upregulation contributes to Nrf2's protective function. However, it also caused corneocyte fragility and impaired desquamation, followed by alterations in the epidermal lipid barrier, inflammation and overexpression of mitogens that induced keratinocyte hyperproliferation. These results identify an unexpected role of Nrf2 in epidermal barrier function, which needs to be considered for pharmacological use of Nrf2 activators.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Abstract In humans, the skin is the largest organ of the body, covering up to 2m2 and weighing up to 4kg in an average adult. Its function is to preserve the body from external insults and also to retain water inside. This barrier function termed epidermal permeability barrier (EPB) is localized in the functional part of the skin: the epidermis. For this, evolution has built a complex structure of cells and lipids sealing the surface, the stratum corneum. The formation of this structure is finely tuned since it is not only formed once at birth, but renewed all life long. This active process gives a high plasticity and reactivity to skin, but also leads to various pathologies. ENaC is a sodium channel extensively studied in organs like kidney and lung due to its importance in regulating sodium homeostasis and fluid volume. It is composed of three subunits α, ß and r which are forming sodium selective channel through the cell membrane. Its presence in the skin has been demonstrated, but little is known about its physiological role. Previous work has shown that αENaC knockout mice displayed an abnormal epidermis, suggesting a role in differentiation processes that might be implicated in the EPB. The principal aim of this thesis has been to study the consequences for EPB function in mice deficient for αENaC by molecular and physiological means and to investigate the underlying molecular mechanisms. Here, the barrier function of αENaC knockout pups is impaired. Apparently not immediately after birth (permeability test) but 24h later, when evident water loss differences appeared compared to wildtypes. Neither the structural proteins of the epithelium nor the tights junctions showed any obvious alterations. In contrary, stratum corneum lipid disorders are most likely responsible for the barrier defect, accompanied by an impairment of skin surface acidification. To analyze in details this EPB defect, several hypotheses have been proposed: reduced sensibility to calcium which is the key activator far epidermal formation, or modification of ENaC-mediated ion fluxes/currents inside the epidermis. The cellular localization of ENaC and the action in the skin of CAPl, a positive regulator of ENaC, have been also studied in details. In summary, this study clearly demonstrates that ENaC is a key player in the EPB maintenance, because αENaC knockout pups are not able to adapt to the new environment (ex utero) as efficiently as the wildtypes, most likely due to impaired of sodium handling inside the epidermis. Résumé Chez l'homme, la peau est le plus grand organe, couvrant presque 2m2 et pesant près de 4kg chez l'adulte. Sa fonction principale est de protéger l'organisme des agressions extérieures mais également de conserver l'eau à l'intérieur du corps. Cette fonction nommée barrière épithéliale est localisée dans la partie fonctionnelle de la peau : l'épiderme. A cette fin, l'évolution s'est dotée d'une structure complexe composée de cellules et de lipides recouvrant la surface, la couche cornée. Sa formation est finement régulée, car elle n'est pas seulement produite à la naissance mais constamment renouvelée tout au long de la vie, ce qui lui confère une grande plasticité mais ce qui est également la cause de nombreuses pathologies. ENaC est un canal sodique très étudié dans le rein et le poumon pour son importance dans la régulation de l'homéostasie sodique et la régulation du volume du milieu intérieur. Il est composé de 3 sous unités, α, ß et y qui forment un pore sélectif pour le sodium dans les membranes. Ce canal est présent dans la peau mais sa fonction n'y est pas connue. Des travaux précédents ont pu montrer que les souris dont le gène codant pour αENaC a été invalidé présentent un épiderme pathologique, suggérant un rôle dans la différentiation et pourrait même être impliqué dans la barrière épithéliale. Le but de cette thèse fut l'étude de la barrière dans ces souris knockouts avec des méthodes moléculaires et physiologiques et la caractérisation des mécanismes moléculaire impliqués. Dans ce travail, il a été montré que les souris mutantes présentaient un défaut de la barrière. Ce défaut n'est pas visible immédiatement à la naissance (test de perméabilité), mais 24h plus tard, lorsque les tests de perte d'eau transépithéliale montrent une différence évidente avec les animaux contrôles. Ni les protéines de structures ni les jonctions serrées de l'épiderme ne présentaient d'imperfections majeures. A l'inverse, les lipides de la couche cornée présentaient un problème de maturation (expliquant le phénotype de la barrière), certainement consécutif au défaut d'acidification à la surface de la peau que nous avons observé. D'autres mécanismes ont été explorées afin d'investiguer cette anomalie de la barrière, comme la réduction de sensibilité au calcium qui est le principal activateur de la formation de l'épiderme, ou la modification des flux d'ions entre les couches de l'épiderme. La localisation cellulaire d'ENaC, et l'action de son activateur CAPl ont également été étudiés en détails. En résumé, cette étude démontre clairement qu'ENaC est un acteur important dans la formation de la barrière épithéliale, car la peau des knockouts ne s'adapte pas aussi bien que celle des sauvages au nouvel environnement ex utero à cause de la fonction d'ENaC dans les mouvements de sodium au sein même de l'épiderme. Résumé tout public Chez l'homme, la peau est le plus grand organe, couvrant presque 2m2 et pesant près de 4kg chez l'adulte. Sa fonction principale est de protéger l'organisme des agressions extérieures mais également de conserver l'eau à l'intérieur du corps. Cette fonction nommée barrière épithéliale est localisée dans la partie fonctionnelle de la peau : l'épiderme. A cette fin, l'évolution s'est dotée d'une structure complexe composée de cellules et de lipides recouvrant la surface, la couche cornée. Sa formation est finement régulée, car elle n'est pas seulement produite à la naissance mais constamment renouvelée tout au long de la vie, ce qui lui confère une grande plasticité mais ce qui est également la cause de nombreuses maladies. ENaC est une protéine formant un canal qui permet le passage sélectif de l'ion sodium à travers la paroi des cellules. Il est très étudié dans le rein pour son importance dans la récupération du sel lors de la concentration de l'urine. Ce canal est présent dans la peau mais sa fonction n'y est pas connue. Des travaux précédents ont pu montrer que les souris où le gène codant pour αENaC a été invalidé présentent un épiderme pathologique, suggérant un rôle dans la peau et plus particulièrement la fonction de barrière de l'épiderme. Le but de cette thèse fut l'étude de la fonction de barrière dans ces souris mutantes, au niveau tissulaire et cellulaire. Dans ce travail, il a été montré que les souris mutantes présentaient une peau plus perméable que celle des animaux contrôles, grâce à une machine mesurant la perte d'eau à travers la peau. Ce défaut n'est visible que 24h après la naissance, mais nous avons pu montrer que les animaux mutants perdaient quasiment 2 fois plus d'eau que les contrôles. Au niveau moléculaire, nous avons pu montrer que ce défaut provenait d'un problème de maturation des lipides qui composent la barrière de la peau. Cette maturation est incomplète vraisemblablement à cause d'un défaut de mouvement des ions dans les couches les plus superficielles de l'épiderme, et cela à cause de l'absence du canal ENaC. En résumé, cette étude démontre clairement qu'ENaC est un acteur important dans la formation de la barrière épithéliale, car la peau des mutants ne s'adapte pas aussi bien que celle des sauvages au nouvel environnement ex utero à cause de la fonction d'ENaC dans les mouvements de sodium au sein même de l'épiderme.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The highly amiloride-sensitive epithelial sodium channel ENaC is well known to be involved in controlling whole body sodium homeostasis and lung liquid clearance. ENaC expression has also been detected in the skin of amphibians and mammals. Mice lacking ENaC expression lose rapidly weight associated with an epidermal barrier defect that develops following birth. This dehydration is accompanied with a highly abnormal lipid matrix composition and an impaired skin surface acidification. This strongly suggests a role of ENaC in the maturation of barrier function rather than in the prenatal generation of the barrier, and may be as such an important modulator for skin hydration. In parallel, gene targeting experiments of regulators of ENaC activity, membrane serine proteases, also termed channel activating proteases, like CAP1/Prss8 and matriptase/MT-SP1 by themselves have been shown to be crucial for the epidermal barrier function. In our review, we mainly focus on the role of ENaC and its regulators in the skin and discuss their importance in the epidermal permeability barrier function.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Intestinal infection with Salmonella enterica serotype Enteritidis, a food-borne infection spread to humans especially through contaminated eggs and egg-products as well as undercooked contaminated fresh meat, is the most common cause of intestinal inflammation in the European Union. Enteritis caused by Salmonella Enteritidis is characterized by fever, diarrhoea and abdominal pain. The disruption of the intestinal epithelial barrier function contributes to diarrhoea and is responsible for the perpetuation of the inflammatory process. In this sense, oxidative stress and the proinflammatory cytokines TNF-α, IFN-γ and IL-1β are described to induce the disorganization of the tight junctions (TJ), the most apical epithelial intercellular junctions and responsible for the paracellular permeability. The interest of this chapter relies not only in the investigation dealing with the mechanisms of TJ regulation but also in the contribution to the development of new tools for the prevention of epithelial barrier disruption in enteritis caused by Salmonella Enteritidis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Ulcerative colitis (UC) is characterized by impairment of the epithelial barrier and the formation of ulcer-type lesions, which result in local leaks and generalized alterations of mucosal tight junctions. Ultimately, this results in increased basal permeability. Although disruption of the epithelial barrier in the gut is a hallmark of inflammatory bowel disease and intestinal infections, it remains unclear whether barrier breakdown is an initiating event of UC or rather a consequence of an underlying inflammation, evidenced by increased production of proinflammatory cytokines. UC is less common in smokers, suggesting that the nicotine in cigarettes may ameliorate disease severity. The mechanism behind this therapeutic effect is still not fully understood, and indeed it remains unclear if nicotine is the true protective agent in cigarettes. Nicotine is metabolized in the body into a variety of metabolites and can also be degraded to form various breakdown products. It is possible these metabolites or degradation products may be the true protective or curative agents. A greater understanding of the pharmacodynamics and kinetics of nicotine in relation to the immune system and enhanced knowledge of out permeability defects in UC are required to establish the exact protective nature of nicotine and its metabolites in UC. This review suggests possible hypotheses for the protective mechanism of nicotine in UC, highlighting the relationship between gut permeability and inflammation, and indicates where in the pathogenesis of the disease nicotine may mediate its effect.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fecal water (FW) has been shown to exert, in cultured cells, cytotoxic and genotoxic effects that have implications for colorectal cancer (CRC) risk. We have investigated a further biological activity of FW, namely, the ability to affect gap junctions in CACO2 cell monolayers as an index of mucosal barrier function, which is known to be disrupted in cancer. FW samples fi-om healthy, free-living, European subjects that were divided into two broad age groups, adult (40 +/- 9.7 yr; n = 53) and elderly (76 +/- 7.5 yr; n = 55) were tested for effects on gap junction using the transepithelial resistance (TER) assay. Overall, treatment of CACO2 cells with FW samples fi-om adults increased TER (+ 4 %), whereas FW from elderly subjects decreased TER (-5%); the difference between the two groups was significant (P < 0.05). We also measured several components of FW potentially associated with modulation of TER, namely, short-chain fatty acid (SCFA) and ammonia. SCFAs (propionic, acetic, and n-butyric) were significantly lower in the elderly population (-30%, -35%, and -21%, respectively, all P pound 0.01). We consider that FW modulation of in vitro epithelial barrier function is a potentially useful noninvasive biomarker, but it requires further validation to establish its relationship to CRC risk.