Microleakage into and from Two-Stage Implants: An In Vitro Comparative Study

Purpose: Gaps between an abutment and a dental implant are unavoidable, and microleakage may occur, leading to problems such as malodor and peri-implantitis. The aim of the present in vitro study was to investigate leakage of Staphylococcus aureus through the implant/abutment interface by the method of bacterial culture, and to compare the leakage rates of two different types of implant-abutment connections. Materials and Methods: Twenty Morse taper implants with abutments were divided into two groups: group A, which were evaluated for microleakage into the inner part of the implants, and group B, which were evaluated for microleakage from the inner part of the implants. Twenty internal-hexagon implants with abutments were also divided into two groups: group C, which were evaluated for microleakage into the inner part of the implants, and group D, which were evaluated for microleakage from the inner part of the implants. For the evaluation of leakage from the implants, the assemblies had the inner parts inoculated with S aureus, and each assembly was incubated in sterile brain heart infusion broth for 1 week. For assessment of leakage into the implants, each assembly was submerged in 4 mL S aureus culture in tubes and incubated for 2 weeks. The microleakage of the two implant connections was compared. Results: Microbial leakage occurred in all groups, and there was no statistically significant difference between groups A and C or between groups B and D. Conclusions: In vitro, S aureus leakage through the implant/abutment interface occurred with both Morse taper and internal-hexagon implants. INT J ORAL MAXILLOFAC IMPLANTS 2011;26:56-62

Bacterial leakage along the implant-abutment interface of premachined or cast components

In recent clinical studies, contamination of the inner parts of dental implants through bacterial penetration along the implant components has been observed. The aim of the present in-vitro study was to investigate leakage of Fusobacterium. nucleatum through the interface between implants and premachined or cast abutments. Both premachined (n = 10) and cast (n = 10) implant abutment assemblies were inoculated with 3.0 mu L of microbial inoculum. The assemblies were completely immersed in 5.0 mL of tryptic soy broth culture medium to observe leakage at the implant-abutment interface after 14 days of anaerobic incubation. Bacterial growth in the medium, indicative of microbial leakage, was found only in 1 out of 9 samples (11.1%) in each group. Both premachined and cast abutments connected to external hexagonal implants provide low percentages of bacterial leakage through the interface in in vitro unloaded conditions if the manufacturer`s instructions and casting procedures are properly followed.

Leakage of Saliva Through the Implant-Abutment Interface: In Vitro Evaluation of Three Different Implant Connections Under Unloaded and Loaded Conditions

Purpose: Bacterial leakage along the implant-abutment interface, with consequent species harboring the inner parts of two-part dental implant systems, has been reported in the literature. The aim of this in vitro study was to evaluate bacterial leakage from human saliva to the internal part of the implants along the implant-abutment interface under loaded and unloaded conditions using DNA Checkerboard. Materials and Methods: Sixty denial implants-20 each of external-hexagon, internal-hexagon, and Morse cone-connection designs-and their conical abutments were used in this study. Each group was subdivided into two groups of 10 loaded and 10 unloaded implants. The assemblies were immersed in human saliva and either (1) loaded with 500,000 cycles at 120 N (experimental group) or (2) incubated in static conditions for 7 days at 35 degrees C (unloaded control group). Results: Microorganisms were found in the internal surfaces of all types of connections. The Morse cone connection presented the lowest count of microorganisms in both the unloaded and loaded groups. Loaded implants presented with higher counts of microorganisms than unloaded implants for external- and internal-hex connections. Conclusion: Bacterial species from human saliva may penetrate along the implant-abutment interface under both unloaded and loaded conditions for all connections evaluated. Morse cone-connection implants showed the lowest counts of microorganisms for both conditions. External- and internal-hex implants showed a higher incidence of bacteria and higher bacterial counts after simulated loading. INT J ORAL MAXILLOFAC IMPLANTS 2012;27:551-560.

Predicting the thermal inactivation of bacteria in a solid matrix: simulation studies on the relative effects of microbial thermal resistance parameters and process conditions

A combined mathematical model for predicting heat penetration and microbial inactivation in a solid body heated by conduction was tested experimentally by inoculating agar cylinders with Salmonella typhimurium or Enterococcus faecium and heating in a water bath. Regions of growth where bacteria had survived after heating were measured by image analysis and compared with model predictions. Visualisation of the regions of growth was improved by incorporating chromogenic metabolic indicators into the agar. Preliminary tests established that the model performed satisfactorily with both test organisms and with cylinders of different diameter. The model was then used in simulation studies in which the parameters D, z, inoculum size, cylinder diameter and heating temperature were systematically varied. These simulations showed that the biological variables D, z and inoculum size had a relatively small effect on the time needed to eliminate bacteria at the cylinder axis in comparison with the physical variables heating temperature and cylinder diameter, which had a much greater relative effect. (c) 2005 Elsevier B.V All rights reserved.

Selected wheat seed defense proteins exhibit competitive binding to model microbial lipid interfaces

Puroindolines (Pins) and purothionins (Pths) are basic, amphiphilic, cysteine-rich wheat proteins that play a role in plant defense against microbial pathogens. We have examined the co-adsorption and sequential addition of Pins (Pin-a, Pin-b and a mutant form of Pin-b with Trp-44 to Arg-44 substitution) and β-purothionin (β-Pth) model anionic lipid layers, using a combination of surface pressure measurements, external reflection FTIR spectroscopy and neutron reflectometry. Results highlighted differences in the protein binding mechanisms, and in the competitive binding and penetration of lipid layers between respective Pins and β-Pth. Pin-a formed a blanket-like layer of protein below the lipid surface that resulted in the reduction or inhibition of β-Pth penetration of the lipid layer. Wild-type Pin-b participated in co-operative binding with β-Pth, whereas the mutant Pin-b did not bind to the lipid layer in the presence of β-Pth. The results provide further insight into the role of hydrophobic and cationic amino acid residues in antimicrobial activity.

CLSM assessment of tubule penetration and bacterial leakage evaluation of two resin-based sealer

Aim: The aims of this study were to assess the penetration of two endodontic sealers (salicylate and epoxy resin-based sealers) into dentinal tubules using CLSM; and to evaluate the bacterial leakage of roots filled with the same sealers associated with gutta-percha. Material and Methods: For sealer penetrability assessment, thirty bovine roots were instrumented and divided into three groups: AHP: EDTA + filling with AH Plus and gutta-percha (n=10), MTAF: EDTA + filling with MTA Fillapex and gutta-percha (n=10), control group: canals were not irrigated with EDTA and were filled with gutta-percha and AH Plus (n=5) or MTA Fillapex (n=5). Rhodamine B was added to the sealers in order to provide adequate fluorescence. The roots were transversely sectioned 3mm from the apex to enable CLSM analysis. Leakage was evaluated for turbidity of the broth in a split chamber model system for 30 days, using Enterococcus faecalis as a microbial marker. Thirty roots were instrumented and divided in four grupos: AHP: filling with AH Plus and gutta-percha (n=10); MTAF: filling with MTA Fillapex and gutta-percha (n=10); positive control: filling with gutta-percha without sealer (n = 5); negative control: sealing with cyanoacrylate to test the seal of the system (n = 5). Results: The medians for dentinal tubule penetration were 6.8% (AHP) and 6.6% (MTAF) (P = 0.82). The average time for bacterial leakage was 8 days in both experimental groups (P = 0.79). Conclusion: MTA Fillapex and AH Plus presented similar behavior regarding dentinal tubule penetration and bacterial leakage.

Microbial community, biomarker concentrations and their isotopic signature in sediment of Gullfaks and Tommeliten methane seeps in the Northern North Sea

Gullfaks is one of the four major Norwegian oil and gas fields, located in the northeastern edge of the North Sea Plateau. Tommeliten lies in the greater Ekofisk area in the central North Sea. During the cruises HE 208 and AL 267 several seep locations of the North Sea were visited. At the Heincke seep at Gullfaks, sediments were sampled in May 2004 (HE 208) using a video-guided multiple corer system (MUC; Octopus, Kiel). The samples were recovered from an area densely covered with bacterial mats where gas ebullition was observed. The coarse sands limited MUC penetration depth to maximal 30 centimeters and the highly permeable sands did not allow for a high-resolution, vertical subsampling because of pore water loss. The gas flare mapping and videographic observation at Tommeliten indicated an area of gas emission with a few small patches of bacterial mats with diameters <50 cm from most of which a single stream of gas bubbles emerged. The patches were spaced apart by 10-100 m. Sampling of sediments covered by bacterial mats was only possible with 3 small push cores (3.8 cm diameter) mounted to ROV Cherokee. These cores were sampled in 3 cm intervals. Lipid biomarker extraction from 10 -17 g wet sediment was carried out as described in detail elsewhere (Elvert et al., 2003; doi:10.1080/01490450303894). Briefly, defined concentrations of cholestane, nonadecanol and nonadecanolic acid with known delta 13C-values were added to the sediments prior to extraction as internal standards for the hydrocarbon, alcohol and fatty acid fraction, respectively. Total lipid extracts were obtained from the sediment by ultrasonification with organic solvents of decreasing polarity. Esterified fatty acids (FAs) were cleaved from the glycerol head group by saponification with methanolic KOH solution. From this mixture, the neutral fraction was extracted with hexane. After subsequent acidification, FAs were extracted with hexane. For analysis, FAs were methylated using BF3 in methanol yielding fatty acid methyl esters (FAMES). The fixation for total cell counts and CARD-FISH were performed on-board directly after sampling. For both methods, sediments were fixed in formaldehyde solution. After two hours, aliquots for CARD-FISH staining were washed with 1* PBS (10mmol/l sodium phosphate solution, 130mmol/l NaCl, adjusted to a pH of 7.2) and finally stored in a 1:1 PBS:ethanol solution at -20°C until further processing. Samples for total cell counts were stored in formalin at 4°C until analysis. For sandy samples, the total cell count/CARD-FISH protocol was optimized to separate sand particles from the cells. Cells were dislodged from sediment grains and brought into solution with the supernatant by sonicating each sample onice for 2 minutes at 50W. This procedure was repeated four times and supernatants were combined. The sediment samples were brought to a final dilution of 1:2000 to 1:4000 and filtered onto 0.2µm GTTP filters (Millipore, Eschbonn, Germany).

Benthic organic carbon flux and oxygen penetration depth in the Southern Ocean

For the investigation of organic carbon fluxes reaching the seafloor, oxygen microprofiles were measured at 145 sites in different sub-regions of the Southern Ocean. At eleven sites, an in situ oxygen microprofiler was deployed for the measurement of oxygen profiles and the calculation of organic carbon fluxes. At four sites, both in situ and ex situ data were determined for high latitudes. Based on this dataset as well as on previous published data, a relationship was established for the estimation of fluxes derived by ex situ measured O2 profiles. The fluxes of labile organic matter range from 0.5 to 37.1 mgC m**2/day. The high values determined by in situ measurements were observed in the Polar Front region (water depth of more than 4290 m) and are comparable to organic matter fluxes observed for high-productivity, upwelling areas like off West Africa. The oxygen penetration depth, which reflects the long-term organic matter flux to the sediment, was correlated with assemblages of key diatom species. In the Scotia Sea (~3000 m water depth), oxygen penetration depths of less than 15 cm were observed, indicating high benthic organic carbon fluxes. In contrast, the oxic zone extends down to several decimeters in abyssal sediments of the Weddell Sea and the southeastern South Atlantic. The regional pattern of organic carbon fluxes derived from micro-sensor data suggest that episodic and seasonal sedimentation pulses are important for the carbon supply to the seafloor of the deep Southern Ocean.

Microbial community composition of sandy intertidal sediments of Sylt-Rømø Basin, Wadden Sea

Molecular biological methods were used to investigate the microbial diversity and community structure in intertidal sandy sediments near the island of Sylt (Wadden Sea) at a site which was characterized for transport and mineralization rates in de Beer et al., (2005, hdl:10013/epic.21375). The sampling was performed during low tide in the middle of the flat, approximately 40 m in the offshore direction from the high water line on October 6, 1999, March 7, 2000, and July 5, 2000. Two parallel cores were collected from each season for molecular analyses. Within 2 h after sampling the sediment cores were sub-sampled and fixed in formaldehyde for FISH analysis. The cells were hybridized, stained with 4',6'-diamidino-2-phenylindole (DAPI) and microscopically counted as described previously [55]. Details of probes and formamide concentrations which were used are shown in further details. Counts are reported as means calculated from 10-15 randomly chosen microscopic fields corresponding to 700-1000 DAPI-stained cells. Values were corrected for the signals counted with the probe NON338. Fluorescence in situ hybridization (FISH)with group-specific rRNA-targeted oligonucleotide probes were used to characterize the microbial community structure over depth (0-12 cm) and seasons (March, July, October). We found high abundances of bacteria with total cell numbers up to 3×109 cells ml-1 and a clear seasonal variation, with higher values in July and October versus March. The microbial community was dominated by members of the Planctomycetes, the Cytophaga/Flavobacterium group, Gammaproteobacteria, and bacteria of the Desulfosarcina/Desulfococcus group. The high abundance (1.5×10**7 - 1.8×10**8 cells/ml accounting for 3-19% of all cells) of presumably aerobic heterotrophic polymer-degrading planctomycetes is in line with the high permeability, deep oxygen penetration, and the high rates of aerobic mineralization of algal biomass measured in the sandy sediments by de Beer et al., (2005, hdl:10013/epic.21375). The high and stable abundance of members of the Desulfosarcina/Desulfococcus group, both over depth and season, suggests that these bacteria may play a more important role than previously assumed based on low sulfate reduction rates in parallel cores de Beer et al., (2005).

Microbial Evaluation Of Traumatized Teeth Treated With Triple Antibiotic Paste Or Calcium Hydroxide With 2% Chlorhexidine Gel In Pulp Revascularization.

Revascularization outcome depends on microbial elimination because apical repair will not happen in the presence of infected tissues. This study evaluated the microbial composition of traumatized immature teeth and assessed their reduction during different stages of the revascularization procedures performed with 2 intracanal medicaments. Fifteen patients (7-17 years old) with immature teeth were submitted to the revascularization procedures; they were divided into 2 groups according to the intracanal medicament used: TAP group (n = 7), medicated with a triple antibiotic paste, and CHP group (n = 8), dressed with calcium hydroxide + 2% chlorhexidine gel. Samples were taken before any treatment (S1), after irrigation with 6% NaOCl (S2), after irrigation with 2% chlorhexidine (S3), after intracanal dressing (S4), and after 17% EDTA irrigation (S5). Cultivable bacteria recovered from the 5 stages were counted and identified by means of polymerase chain reaction assay (16S rRNA). Both groups had colony-forming unit counts significantly reduced after S2 (P < .05); however, no significant difference was found between the irrigants (S2 and S3, P = .99). No difference in bacteria counts was found between the intracanal medicaments used (P = .95). The most prevalent bacteria detected were Actinomyces naeslundii (66.67%), followed by Porphyromonas endodontalis, Parvimonas micra, and Fusobacterium nucleatum, which were detected in 33.34% of the root canals. An average of 2.13 species per canal was found, and no statistical correlation was observed between bacterial species and clinical/radiographic features. The microbial profile of infected immature teeth is similar to that of primarily infected permanent teeth. The greatest bacterial reduction was promoted by the irrigation solutions. The revascularization protocols that used the tested intracanal medicaments were efficient in reducing viable bacteria in necrotic immature teeth.

Phylogenetic Analysis Of The Microbial Community In Hypersaline Petroleum Produced Water From The Campos Basin.

In this work the archaea and eubacteria community of a hypersaline produced water from the Campos Basin that had been transported and discharged to an onshore storage facility was evaluated by 16S recombinant RNA (rRNA) gene sequence analysis. The produced water had a hypersaline salt content of 10 (w/v), had a carbon oxygen demand (COD) of 4,300 mg/l and contains phenol and other aromatic compounds. The high salt and COD content and the presence of toxic phenolic compounds present a problem for conventional discharge to open seawater. In previous studies, we demonstrated that the COD and phenolic content could be largely removed under aerobic conditions, without dilution, by either addition of phenol degrading Haloarchaea or the addition of nutrients alone. In this study our goal was to characterize the microbial community to gain further insight into the persistence of reservoir community members in the produced water and the potential for bioremediation of COD and toxic contaminants. Members of the archaea community were consistent with previously identified communities from mesothermic reservoirs. All identified archaea were located within the phylum Euryarchaeota, with 98 % being identified as methanogens while 2 % could not be affiliated with any known genus. Of the identified archaea, 37 % were identified as members of the strictly carbon-dioxide-reducing genus Methanoplanus and 59 % as members of the acetoclastic genus Methanosaeta. No Haloarchaea were detected, consistent with the need to add these organisms for COD and aromatic removal. Marinobacter and Halomonas dominated the eubacterial community. The presence of these genera is consistent with the ability to stimulate COD and aromatic removal with nutrient addition. In addition, anaerobic members of the phyla Thermotogae, Firmicutes, and unclassified eubacteria were identified and may represent reservoir organisms associated with the conversion hydrocarbons to methane.

Microbial Lipid Production: Screening With Yeasts Grown On Brazilian Molasses.

Rhodotorula glutinis CCT 2182, Rhodosporidium toruloides CCT 0783, Rhodotorula minuta CCT 1751 and Lipomyces starkeyi DSM 70296 were evaluated for the conversion of sugars from Brazilian molasses into single-cell oil (SCO) feedstock for biodiesel. Pulsed fed-batch fermentations were performed in 1.65 l working volume bioreactors. The maximum specific growth rate (µmax), lipid productivity (Pr) and cellular lipid content were, respectively, 0.23 h(-1), 0.41 g l(-1) h(-1), and 41% for Rsp. toruloides; 0.20 h(-1), 0.27 g l(-1) h(-1), and 36% for Rta. glutinis; 0.115 h(-1), 0.135 g l(-1) h(-1), and 27 % for Rta. minuta; and 0.11 h(-1), 0.13 g l(-1) h(-1), and 32% for L. starkeyi. Based on their microbial lipid productivity, content, and profile, Rsp. toruloides and Rta. glutinis are promising candidates for biodiesel production from Brazilian molasses. All the oils from the yeasts were similar to the composition of plant oils (rapeseed and soybean) and could be used as raw material for biofuels, as well as in food and nutraceutical products.

Comparative Metagenomic Analysis Of Coral Microbial Communities Using A Reference-independent Approach.

By comparing the SEED and Pfam functional profiles of metagenomes of two Brazilian coral species with 29 datasets that are publicly available, we were able to identify some functions, such as protein secretion systems, that are overrepresented in the metagenomes of corals and may play a role in the establishment and maintenance of bacteria-coral associations. However, only a small percentage of the reads of these metagenomes could be annotated by these reference databases, which may lead to a strong bias in the comparative studies. For this reason, we have searched for identical sequences (99% of nucleotide identity) among these metagenomes in order to perform a reference-independent comparative analysis, and we were able to identify groups of microbial communities that may be under similar selective pressures. The identification of sequences shared among the metagenomes was found to be even better for the identification of groups of communities with similar niche requirements than the traditional analysis of functional profiles. This approach is not only helpful for the investigation of similarities between microbial communities with high proportion of unknown reads, but also enables an indirect overview of gene exchange between communities.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Microbial distribution in the root canal system after periapical lesion induction using different methods

The aim of this study was to evaluate the microbial distribution in the root canal system after periapical lesion induction in dogs' teeth using different methods. Fifty-two root canals were assigned to 4 groups (n=13). Groups I and II: root canals were exposed to the oral cavity for 180 days; groups III and IV: root canals were exposed for 7 days and then the coronal openings were sealed for 53 days. The root apices of groups I and III were perforated, while those of groups II and IV remained intact. After the experimental periods, the animals were euthanized and the anatomic pieces containing the roots were processed and stained with the Brown & Brenn method to assess the presence and distribution of microorganisms. The incidence of microorganisms at different sites of the roots and periapical lesions was analyzed statistically by the chi-square test at 5% significance level. All groups presented microorganisms in the entire root canal system. A larger number of microorganisms was observed on the root canal walls, apical delta and dentinal tubules (p<0.05), followed by cementum and cemental resorption areas. In spite of the different periods of exposure to the oral environment, the methods used for induction of periapical periodontitis yielded similar distribution of microorganisms in the root canal system.