17 resultados para Loricrin
Resumo:
Filaggrin is a keratin filament associated protein that is expressed in granular layer keratinocytes and derived by sequential proteolysis from a polyprotein precursor termed profilaggrin. Depending on the species, each profilaggrin molecule contains between 10 and 20 filaggrin subunits organized as tandem repeats with a calcium-binding domain at the N-terminal end. We now report the characterization of the complete mouse gene. The structural organization of the mouse gene is identical to the human profilaggrin gene and consists of three exons with a 4 kb intron within the 5' noncoding region and a 1.7 kb intron separating the sequences encoding the calcium-binding EF-hand motifs. A processed pseudogene was found embedded within the second intron. The third and largest exon encodes the second EF-hand, a basic domain (designated the B-domain) followed by 12 filaggrin repeats and a unique C-terminal tail domain. A polyclonal anti-body raised against the conceptually translated sequence of the B-domain specifically stained keratohyalin granules and colocalized with a filaggrin antibody in granular layer cells. In upper granular layer cells, B-domain containing keratohyalin granules were in close apposition to the nucleus and, in some cells, appeared to be completely engulfed by the nucleus. In transition layer cells, B-domain staining was evident in the nucleus whereas filaggrin staining remained cytoplasmic. Nuclear staining of the B-domain was also observed in primary mouse keratinocytes induced to differentiate. This study has also revealed significant sequence homology between the mouse and human promoter sequences and in the calcium-binding domain but the remainder of the protein-coding region shows substantial divergence.
Resumo:
The ichthyoses are a heterogeneous group of monogenetically inherited disorders of cornification, and characterized clinically by scaling or hyperkeratosis. Historically, they were classified by clinical features and inheritance patterns. As a result of the recent molecular biological revolution, the ichthyoses are now recognized as comprising many diverse entities. Importantly, identical phenotypes may be caused by mutations in multiple genes, while mutations in a single gene may result in multiple and sometimes widely divergent phenotypes. The considerable complexity of this clinically and genetically heterogeneous group of disorders has prompted the need for a new classification. A classification that uses terminology based on a combination of the clinical and molecular genetic details, for instance loricrin keratoderma, is desirable. In this chapter we will use in principle the nosology adopted recently by an international group of experts at the First Ichthyosis Consensus Conference in Sorèz, France.
Resumo:
The homeodomain-only protein (HOP) contains an atypical homeodomain which is unable to bind to DNA due to mutations in residues important for DNA binding. Recently, HOP was reported to regulate proliferation/differentiation homeostasis in different cell types. In the present study, we performed transcriptional profiling of cultured primary human keratinocytes and noted a robust induction of HOP upon calcium-induced cell differentiation. Immunohistochemistry of human skin localized HOP to the granular layer in the epidermis. Overexpression of HOP using a lentiviral vector up-regulated FLG and LOR expression during keratinocyte differentiation. Conversely, decreasing HOP expression using small interfering RNA markedly reduced the calcium-induced expression of late markers of differentiation in vitro, with the most prominent effect on profilaggrin (FLG) mRNA. Moreover, mRNA levels of profilaggrin and loricrin were downregulated in the epidermis of HOP knockout mice. Analysis of skin disorders revealed altered HOP expression in lichen planus, psoriasis and squamous cell carcinoma (SCC). Our data indicate that HOP is a novel modulator of late terminal differentiation in keratinocytes.
Resumo:
Previous studies demonstrated that peroxisome-proliferator-activated receptor (PPAR)-alpha or PPAR-delta activation stimulates keratinocyte differentiation, is anti-inflammatory, and improves barrier homeostasis. Here we demonstrate that treatment of cultured human keratinocytes with ciglitazone, a PPAR-gamma activator, increases involucrin and transglutaminase 1 mRNA levels. Moreover, topical treatment of hairless mice with ciglitazone or troglitazone increases loricrin, involucrin, and filaggrin expression without altering epidermal morphology. These results indicate that PPAR-gamma activation stimulates keratinocyte differentiation. Additionally, PPAR-gamma activators accelerated barrier recovery following acute disruption by either tape stripping or acetone treatment, indicating an improvement in permeability barrier homeostasis. Treatment with PPAR-gamma activators also reduced the cutaneous inflammatory response that is induced by phorbol 12-myristate-13-acetate, a model of irritant contact dermatitis and oxazolone, a model of allergic contact dermatitis. To determine whether the effects of PPAR-gamma activators are mediated by PPAR-gamma, we next examined animals deficient in PPAR-gamma. Mice with a deficiency of PPAR-gamma specifically localized to the epidermis did not display any cutaneous abnormalites on inspection, but on light microscopy there was a modest increase in epidermal thickness associated with an increase in proliferating cell nuclear antigen (PCNA) staining. Key functions of the skin including permeability barrier homeostasis, stratum corneum surface pH, and water-holding capacity, and response to inflammatory stimuli were not altered in PPAR-gamma-deficient epidermis. Although PPAR-gamma activators stimulated loricrin and filaggrin expression in wild-type animals, however, in PPAR-gamma-deficient mice no effect was observed indicating that the stimulation of differentiation by PPAR-gamma activators is mediated by PPAR-gamma. In contrast, PPAR-gamma activators inhibited inflammation in both PPAR-gamma-deficient and wild-type mouse skin, indicating that the inhibition of cutaneous inflammation by these PPAR-gamma activators does not require PPAR-gamma in keratinocytes. These observations suggest that thiazolidindiones and perhaps other PPAR-gamma activators maybe useful in the treatment of cutaneous disorders.
Resumo:
The process of epidermal differentiation involves proliferation, differentiation, migration and maturation of keratinocytes to form an impermeable barrier against water loss and outside environment. It is controlled by highly balanced regulatory machinery, involving many molecules that are still under investigation.Homeobox proteins are involved in body patterning and morphogenesis of organs and are studied as potentially good candidates to regulate this process. In the first project we investigated the role of a protein named HOP which belongs to a group of homeobox proteins. Even if HOP is a small protein almost completely composed of the homeodomain and without DNA binding capacity, it is considered as transcriptional regulator in different tissues. HOP interacts with serum response factor (SRF) and histone deacetylase type 2 (HDAC2). By microarray analysis we found that HOP expression increases in cultured human primary keratinocytes (NHK) which undergo calcium-induced differentiation. HOP protein was localized in granular layer of the epidermis of healthy individuals. Lack of HOP was demonstrated in psoriatic lesions, whereas a strong expression was demonstrated in the lesional skin of patients affected with lichen planus (LP). Since LP is characterized by hypergranulosis while psoriatic lesions by progressive lack of the granular layer, the obtained data indicated that HOP might have a potential function in granular layer of epidermis. To investigate HOP function, we inhibited its expression by using HOP specific StealthRNAi and we overexpressed HOP using lentiviral vectors in differentiating NHK. The conclusion of both experiments indicated that HOP positively regulates the expression of late differentiation markers, such as profilaggrin, loricrin and transglutaminase 1. The in vitro data were next confirmed in vivo using HOP knockout mouse model.The second part of my study involved analysis of mechanisms underlying the pathogenesis of epidermolytic hyperkeratosis (EHK). EHK is a genetic disorder characterized by erythema, skin blistering, keratinocyte hyperproliferation and hyperkeratosis. EHK is caused by mutations in keratin 1 or 10 (K1, K10) which are major structural proteins of differentiated keratinocytes and participate in the cellular scaffold formation. To investigate how the structural proteins carrying mutations alter cellular signaling, we established an in vitro model for EHK by overexpression of one of the most common K10 mutations reported so far (K10R156H), in primary human keratinocytes. In order to mimic the in vivo situation, mutated keratinocytes growing on silicone membranes were subjected to mechanical stretch. We observed strong collapse of KIF in K10R156H keratinocytes when subjected to stretch for 30 minutes. Our data demonstrated stronger activation of p38, a member of MAPK stress signaling pathways, in K10R156H when compared to control cells. We demonstrated also that K10R156H keratinocytes showed an induction of TNF-α and RANTES release in response to stretch.Taken together these studies characterize a novel regulator of epidermal differentiation - HOP and demonstrate new aspects implicated in the pathogenesis of EHK.
Resumo:
Neuropeptides and their receptors are present in human skin, and their importance for cutaneous homeostasis and during wound healing is increasingly appreciated. However, there is currently a lack of understanding of the molecular mechanisms by which their signaling modulates keratinocyte function. Here, we show that δ-opioid receptor (DOPr) activation inhibits proliferation of human keratinocytes, resulting in decreased epidermal thickness in an organotypic skin model. DOPr signaling markedly delayed induction of keratin intermediate filament (KRT10) during in vitro differentiation and abolished its induction in the organotypic skin model. This was accompanied by deregulation of involucrin (IVL), loricrin, and filaggrin. Analysis of the transcription factor POU2F3, which is involved in regulation of KRT10, IVL, and profilaggrin expression, revealed a DOPr-mediated extracellular signal-regulated kinase (ERK)-dependent downregulation of this factor. We propose that DOPr signaling specifically activates the ERK 1/2 mitogen-activated protein kinase pathway to regulate keratinocyte functions. Complementing our earlier studies in DOPr-deficient mice, these data suggest that DOPr activation in human keratinocytes profoundly influences epidermal morphogenesis and homeostasis.
Resumo:
Au regard des agressions environnementales constantes que la peau doit endurer, l'équilibre fragile entre l'expression et la répression des gènes épidermiques, nécessaire à la différentiation et la prolifération des kératinocytes, pourrait facilement être perturbé en l'absence des mécanismes de stabilisation robustes. La présence d'un système neuroendocrinien local est donc importante afin de coordonner une réponse aux éventuelles irritations. En effet, l'expression de plusieurs neurohormones, des neurotransmetteurs et des neuropeptides, y compris des dérivés pro-opiomélanocortine comme la ß-endorphine et [Met5]-enképhaline, ainsi que l'expression du récepteur 8-opioïde (DOR) a été démontré dans la peau. Cependant, les mécanismes moléculaires par lesquels ils modulent la fonction des kératinocytes sont mal connus. Le présent travail démontre que la voie de signalisation DOR active spécifiquement la voie ERK 1/2 MAPK dans les lignées cellulaires de kératinocytes humains, inhibant la prolifération des cellules et entraîne une diminution de l'épaisseur épidermique dans un modèle organotypique de peau. De plus, l'expression de DOR retarde nettement l'induction de la kératine 10 (KRT 10) et la kératine 1 (KRT 1) dans une modèle 2D de différentiation in vitro, et supprime l'induction de KRT 10 dans un modèle organotypique de peau. Ceci est accompagné de la dérégulation de l'involucrine (IVL), la loricrine (LOR) et la fïlaggrin (FLG), résultant en une induction nettement réduite de leur expression lors de l'initiation de la différentiation in vitro. De plus, POU2F3 a été identifié comme un facteur de transcription régulant les gènes de différentiation des kératinocytes modulés par DOR. Il a été démontré que la régulation négative de POU2F3 via la voie DOR-ERK affecte les principaux aspects de la fonction des kératinocytes. Toutefois, il est évident que des facteurs supplémentaires influencent la fonctionnalité de la voie DOR elle-même. Le calcium et le contact cellule-cellule augmentent la quantité des récepteurs à la surface cellulaire des kératinocytes. Les kératinocytes dont les récepteurs sont internalisés ne répondent pas de la même manière que ceux possédant des récepteurs fonctionnels localisée à la membrane. Ce travail suggère que lors de signaux intrinsèques ou extrinsèques spécifiques, les kératinocytes sont capable de répondre via le système opioïdergique neuro-epidermique. Cette réponse doit être spatialement et temporairement contrôlée afin d'éviter un déséquilibre de l'homéostasie épidermique et un retard de cicatrisation. La compréhension de ce processus très complexe pourrait permettre à terme le développement de meilleurs traitements des affections cutanées pathologiques. En complément des études précédentes sur des souris DOR-défïcientes, ces données suggèrent que l'activation de DOR dans les kératinocytes humains influence la morphogenèse et l'homéostasie de l'épiderme, et pourrait jouer un rôle lors du processus de cicatrisation. - In view of the constant environmental assaults that the skin must endure, the delicate balance of an eloquent sequence of epidermal gene expression and repression, that is required for appropriate differentiation and proliferation of keratinocytes, might easily become derailed in the absence of robust stabilizing mechanisms. The presence of a local neuroendocrine system is thereby important to coordinate a response towards irritations. In fact, the expression of several neurohormones, neurotransmitters, and neuropeptides, including proopiomelanocortin derivatives, such as ß- endorphin and [Met5]-enkephalin has been shown in skin, as well as expression of the 6-opioid receptor (DOR). However, there is currently a lack of understanding of the molecular mechanisms by which their signalling modulates keratinocyte function. The present work demonstrates that DOR signalling specifically activates the ERK 1/2 MAPK pathway in human keratinocyte cell lines. This activation inhibits cell proliferation, resulting in decreased epidermal thickness in an organotypic skin model. Furthermore, DOR expression markedly delays induction of keratin intermediate filament Keratin 10 (KRT 10) and KRT 1 during in vitro differentiation, and abolishes the induction of KRT 10 in the organotypic skin model. This is accompanied by deregulation of involucrin (IVL), loricrin (LOR), and filaggrin (FLG), illustrated by a markedly reduced induction of their expression upon initiation of differentiation in vitro. Additionally, POU2F3 was identified as a transcription factor mediating the DOR induced regulation of keratinocyte differentiation related genes. It was revealed that DOR-mediated ERK-dependent downregulation of this factor affects key aspects of keratinocyte function. However, it is evident that additional triggers influence the functionality of the DOR itself. Calcium at concentrations above 0.1 mM and cell-cell contact both enhance the presence of receptor molecules on the keratinocytes cell surface. Keratinocytes with internalized receptor do not respond to DOR ligands in the same way as keratinocytes with a functional membrane localized receptor.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
The ability of Staphylococcus aureus to colonize the human nares is a crucial prerequisite for disease. IsdA is a major S. aureus surface protein that is expressed during human infection and required for nasal colonization and survival on human skin. In this work, we show that IsdA binds to involucrin, loricrin, and cytokeratin K10, proteins that are present in the cornified envelope of human desquamated epithelial cells. To measure the forces and dynamics of the interaction between IsdA and loricrin (the most abundant protein of the cornified envelope), single-molecule force spectroscopy was used, demonstrating high-specificity binding. IsdA acts as a cellular adhesin to the human ligands, promoting whole-cell binding to immobilized proteins, even in the absence of other S. aureus components (as shown by heterologous expression in Lactococcus lactis). Inhibition experiments revealed the binding of the human ligands to the same IsdA region. This region was mapped to the NEAT domain of IsdA. The NEAT domain also was found to be required for S. aureus whole-cell binding to the ligands as well as to human nasal cells. Thus, IsdA is an important adhesin to human ligands, which predominate in its primary ecological niche.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
The homeodomain-only protein (HOP) contains an atypical homeodomain which is unable to bind to DNA due to mutations in residues important for DNA binding. Recently, HOP was reported to regulate proliferation/differentiation homeostasis in different cell types. In the present study, we performed transcriptional profiling of cultured primary human keratinocytes and noted a robust induction of HOP upon calcium-induced cell differentiation. Immunohistochemistry of human skin localized HOP to the granular layer in the epidermis. Overexpression of HOP using a lentiviral vector up-regulated FLG and LOR expression during keratinocyte differentiation. Conversely, decreasing HOP expression using small interfering RNA markedly reduced the calcium-induced expression of late markers of differentiation in vitro, with the most prominent effect on profilaggrin (FLG) mRNA. Moreover, mRNA levels of profilaggrin and loricrin were downregulated in the epidermis of HOP knockout mice. Analysis of skin disorders revealed altered HOP expression in lichen planus, psoriasis and squamous cell carcinoma (SCC). Our data indicate that HOP is a novel modulator of late terminal differentiation in keratinocytes.
Resumo:
Non-melanoma skin cancer (NMSC) is the most frequently diagnosed form of cancer in United States. As in many other cancers, this slow growing malignancy manifests deregulated expression of apoptosis regulating proteins including bcl-2 family member proteins. To understand the role of apoptosis regulating protein in epidermal homeostasis and progression of NMSC, we investigated keratinocyte proliferation, differentiation and tumorigenesis in bcl-2 and bax null mice. The rate and the pattern of proliferation and spontaneous cell death were the same between the null and the control mice. Both bcl-2 and bax null epidermis showed decreased levels of cytokeratin 14 expression compared to the control littermates. Also, the gene knock out mice showed higher expression of cytokeratin 1 and loricrin in epidermis compared to the control mice. The apoptotic response to genotoxic agent, UV radiation (UVR), was assessed by counting sunburn cells. The bax null keratinocytes showed a resistance to apoptosis while bcl-2 null mice showed an increased susceptibility to cell death compared to the control mice. Moreover, we demonstrated an increase in tumor incidence in bax null mice compared to control littermates in the in vivo chemical carcinogenesis study. Next, we examined the tumor suppressor role of bax protein in NMSC by studying its participation in repair of UVR-mediated DNA lesions. In UVR treated primary keratinocytes from bax deficient mice, the level of CPD remaining was twice that of control cells at 48 hours. Similar results were obtained using embryonic fibroblasts from bax null and bax +/+ embryos, and also with a bax deficient prostate cancer cell line in which bax expression had been restored. However, the repair rate of 6-4 PP was unaffected by the absence of bax protein in all three of above mentioned cell types. In conclusion, bax protein may have a dual function in its role as tumor suppressor in NMSC. Bax may directly or indirectly facilitate DNA repair, or programmed cell death if DNA damage is too severe, thus, in either function, preserving genomic integrity following a genotoxic event. ^
Resumo:
The cell envelope (CE) is a specialized structure that is important for barrier function in terminally differentiated stratified squamous epithelia. The CE is formed inside the plasma membrane and becomes insoluble as a result of cross-linking of constituent proteins by isopeptide bonds formed by transglutaminases. To investigate the earliest stages of assembly of the CE, we have studied human epidermal keratinocytes induced to terminally differentiate in submerged liquid culture as a model system for epithelia in general. CEs were harvested from 2-, 3-, 5-, or 7-d cultured cells and examined by 1) immunogold electron microscopy using antibodies to known CE or other junctional proteins and 2) amino acid sequencing of cross-linked peptides derived by proteolysis of CEs. Our data document that CE assembly is initiated along the plasma membrane between desmosomes by head-to-tail and head-to-head cross-linking of involucrin to itself and to envoplakin and perhaps periplakin. Essentially only one lysine and two glutamine residues of involucrin and two glutamines of envoplakin were used initially. In CEs of 3-d cultured cells, involucrin, envoplakin, and small proline-rich proteins were physically located at desmosomes and had become cross-linked to desmoplakin, and in 5-d CEs, these three proteins had formed a continuous layer extending uniformly along the cell periphery. By this time >15 residues of involucrin were used for cross-linking. The CEs of 7-d cells contain significant amounts of the protein loricrin, typically expressed at a later stage of CE assembly. Together, these data stress the importance of juxtaposition of membranes, transglutaminases, and involucrin and envoplakin in the initiation of CE assembly of stratified squamous epithelia.
Resumo:
In prostanoid biosynthesis, the first two steps are catalyzed by cyclooxygenases (COX). In mice and humans, deregulated expression of COX-2, but not of COX-1, is characteristic of epithelial tumors, including squamous cell carcinomas of skin. To explore the function of COX-2 in epidermis, a keratin 5 promoter was used to direct COX-2 expression to the basal cells of interfollicular epidermis and the pilosebaceous appendage of transgenic mouse skin. COX-2 overexpression in the expected locations, resulting in increased prostaglandin levels in epidermis and plasma, correlated with a pronounced skin phenotype. Heterozygous transgenic mice exhibited a reduced hair follicle density. Moreover, postnatally hair follicle morphogenesis and thinning of interfollicular dorsal epidermis were delayed. Adult transgenics showed a body-site-dependent sparse coat of greasy hair, the latter caused by sebaceous gland hyperplasia and increased epicutaneous sebum levels. In tail skin, hyperplasia of scale epidermis reflecting an increased number of viable and cornified cell layers was observed. Hyperplasia was a result of a disturbed program of epidermal differentiation rather than an increased proliferation rate, as reflected by the strong suppression of keratin 10, involucrin, and loricrin expression in suprabasal cells. Further pathological signs were loss of cell polarity, mainly of basal keratinocytes, epidermal invaginations into the dermis, and formation of horn perls. Invaginating hyperplastic lobes were surrounded by CD31-positive vessels. These results demonstrate a causal relationship between transgenic COX-2 expression in basal keratinocytes and epidermal hyperplasia as well as dysplastic features at discrete body sites.
Resumo:
Sun exposure has been clearly implicated in premature skin aging and neoplastic development. These features are exacerbated in patients with xeroderma pigmentosum (XP), a hereditary disease, the biochemical hallmark of which is a severe deficiency in the nucleotide excision repair of UV-induced DNA lesions. To develop an organotypic model of DNA repair deficiency, we have cultured several strains of primary XP keratinocytes and XP fibroblasts from skin biopsies of XP patients. XP skin comprising both a full-thickness epidermis and a dermal equivalent was succesfully reconstructed in vitro. Satisfactory features of stratification were obtained, but the expression of epidermal differentiation products, such as keratin K10 and loricrin, was delayed and reduced. In addition, the proliferation of XP keratinocytes was more rapid than that of normal keratinocytes. Moreover, increased deposition of cell attachment proteins, α-6 and β-1 integrins, was observed in the basement membrane zone, and β-1 integrin subunit, the expression of which is normally confined to basal keratinocytes, extended into several suprabasal cell layers. Most strikingly, the in vitro reconstructed XP skin displayed numerous proliferative epidermal invasions within dermal equivalents. Epidermal invasion and higher proliferation rate are reminiscent of early steps of neoplasia. Compared with normal skin, the DNA repair deficiency of in vitro reconstructed XP skin was documented by long-lasting persistence of UVB-induced DNA damage in all epidermal layers, including the basal layer from which carcinoma develops. The availability of in vitro reconstructed XP skin provides opportunities for research in the fields of photoaging, photocarcinogenesis, and tissue therapy.