1000 resultados para Islanding Detection


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Islanding Detection in Microgrids Using Harmonic Signatures

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In recent years, there has been a growing interest in incorporating microgrids in electrical power networks. This is due to various advantages they present, particularly the possibility of working in either autonomous mode or grid connected, which makes them highly versatile structures for incorporating intermittent generation and energy storage. However, they pose safety issues in being able to support a local island in case of utility disconnection. Thus, in the event of an unintentional island situation, they should be able to detect the loss of mains and disconnect for self-protection and safety reasons. Most of the anti-islanding schemes are implemented within control of single generation devices, such as dc-ac inverters used with solar electric systems being incompatible with the concept of microgrids due to the variety and multiplicity of sources within the microgrid. In this paper, a passive islanding detection method based on the change of the 5th harmonic voltage magnitude at the point of common coupling between grid-connected and islanded modes of operation is presented. Hardware test results from the application of this approach to a laboratory scale microgrid are shown. The experimental results demonstrate the validity of the proposed method, in meeting the requirements of IEEE 1547 standards.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Due to the growing concerns associated with fossil fuels, emphasis has been placed on clean and sustainable energy generation. This has resulted in the increase in Photovoltaics (PV) units being integrated into the utility system. The integration of PV units has raised some concerns for utility power systems, including the consequences of failing to detect islanding. Numerous methods for islanding detection have been introduced in literature. They can be categorized into local methods and remote methods. The local methods are categorically divided into passive and active methods. Active methods generally have smaller Non-Detection Zone (NDZ) but the injecting disturbances will slightly degrade the power quality and reliability of the power system. Slip Mode Frequency Shift Islanding Detection Method (SMS IDM) is an active method that uses positive feedback for islanding detection. In this method, the phase angle of the converter is controlled to have a sinusoidal function of the deviation of the Point of Common Coupling (PCC) voltage frequency from the nominal grid frequency. This method has a non-detection zone which means it fails to detect islanding for specific local load conditions. If the SMS IDM employs a different function other than the sinusoidal function for drifting the phase angle of the inverter, its non-detection zone could be smaller. In addition, Advanced Slip Mode Frequency Shift Islanding Detection Method (Advanced SMS IDM), which has been introduced in this thesis, eliminates the non-detection zone of the SMS IDM. In this method the parameters of SMS IDM change based on the local load impedance value. Moreover, the stability of the system is investigated by developing the dynamical equations of the system for two operation modes; grid connected and islanded mode. It is mathematically proven that for some loading conditions the nominal frequency is an unstable point and the operation frequency slides to another stable point, while for other loading conditions the nominal frequency is the only stable point of the system upon islanding occurring. Simulation and experimental results show the accuracy of the proposed methods in detection of islanding and verify the validity of the mathematical analysis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Power system policies are broadly on track to escalate the use of renewable energy resources in electric power generation. Integration of dispersed generation to the utility network not only intensifies the benefits of renewable generation but also introduces further advantages such as power quality enhancement and freedom of power generation for the consumers. However, issues arise from the integration of distributed generators to the existing utility grid are as significant as its benefits. The issues are aggravated as the number of grid-connected distributed generators increases. Therefore, power quality demands become stricter to ensure a safe and proper advancement towards the emerging smart grid. In this regard, system protection is the area that is highly affected as the grid-connected distributed generation share in electricity generation increases. Islanding detection, amongst all protection issues, is the most important concern for a power system with high penetration of distributed sources. Islanding occurs when a portion of the distribution network which includes one or more distributed generation units and local loads is disconnected from the remaining portion of the grid. Upon formation of a power island, it remains energized due to the presence of one or more distributed sources. This thesis introduces a new islanding detection technique based on an enhanced multi-layer scheme that shows superior performance over the existing techniques. It provides improved solutions for safety and protection of power systems and distributed sources that are capable of operating in grid-connected mode. The proposed active method offers negligible non-detection zone. It is applicable to micro-grids with a number of distributed generation sources without sacrificing the dynamic response of the system. In addition, the information obtained from the proposed scheme allows for smooth transition to stand-alone operation if required. The proposed technique paves the path towards a comprehensive protection solution for future power networks. The proposed method is converter-resident and all power conversion systems that are operating based on power electronics converters can benefit from this method. The theoretical analysis is presented, and extensive simulation results confirm the validity of the analytical work.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Este trabalho estuda a interação entre os métodos anti-ilhamento aplicados em sistemas fotovoltaicos residenciais, operando simultaneamente em uma rede de distribuição de baixa tensão. Os sistemas fotovoltaicos em geral interagem entre si, com a rede de distribuição da concessionária e com outras fontes de geração distribuída. Uma consequência importante dessa interação é a ocorrência do ilhamento, que acontece quando as fontes de geração distribuída fornecem energia ao sistema elétrico de potência mesmo quando esta se encontra eletricamente isolada do sistema elétrico principal. A função anti-ilhamento é uma proteção extremamente importante, devendo estar presente em todos os sistemas de geração distribuída. Atualmente, são encontradas diversas técnicas na literatura. Muitas delas oferecem proteção adequada quando um inversor está conectado à linha de distribuição, mas podem falhar quando dois ou mais funcionam simultaneamente, conectados juntos ou próximos entre si. Dois destes métodos são analisados detalhadamente nesse estudo, avaliados em uma rede de distribuição residencial de baixa tensão. Os resultados obtidos mostram que a influência de um método sobre o outro é dependente da predominância de cada um deles dentro do sistema elétrico. Contudo, nas condições analisadas o ilhamento foi detectado dentro do limite máximo estabelecido pelas normas pertinentes.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Two key solutions to reduce the greenhouse gas emissions and increase the overall energy efficiency are to maximize the utilization of renewable energy resources (RERs) to generate energy for load consumption and to shift to low or zero emission plug-in electric vehicles (PEVs) for transportation. The present U.S. aging and overburdened power grid infrastructure is under a tremendous pressure to handle the issues involved in penetration of RERS and PEVs. The future power grid should be designed with for the effective utilization of distributed RERs and distributed generations to intelligently respond to varying customer demand including PEVs with high level of security, stability and reliability. This dissertation develops and verifies such a hybrid AC-DC power system. The system will operate in a distributed manner incorporating multiple components in both AC and DC styles and work in both grid-connected and islanding modes. The verification was performed on a laboratory-based hybrid AC-DC power system testbed as hardware/software platform. In this system, RERs emulators together with their maximum power point tracking technology and power electronics converters were designed to test different energy harvesting algorithms. The Energy storage devices including lithium-ion batteries and ultra-capacitors were used to optimize the performance of the hybrid power system. A lithium-ion battery smart energy management system with thermal and state of charge self-balancing was proposed to protect the energy storage system. A grid connected DC PEVs parking garage emulator, with five lithium-ion batteries was also designed with the smart charging functions that can emulate the future vehicle-to-grid (V2G), vehicle-to-vehicle (V2V) and vehicle-to-house (V2H) services. This includes grid voltage and frequency regulations, spinning reserves, micro grid islanding detection and energy resource support. The results show successful integration of the developed techniques for control and energy management of future hybrid AC-DC power systems with high penetration of RERs and PEVs.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Two key solutions to reduce the greenhouse gas emissions and increase the overall energy efficiency are to maximize the utilization of renewable energy resources (RERs) to generate energy for load consumption and to shift to low or zero emission plug-in electric vehicles (PEVs) for transportation. The present U.S. aging and overburdened power grid infrastructure is under a tremendous pressure to handle the issues involved in penetration of RERS and PEVs. The future power grid should be designed with for the effective utilization of distributed RERs and distributed generations to intelligently respond to varying customer demand including PEVs with high level of security, stability and reliability. This dissertation develops and verifies such a hybrid AC-DC power system. The system will operate in a distributed manner incorporating multiple components in both AC and DC styles and work in both grid-connected and islanding modes. ^ The verification was performed on a laboratory-based hybrid AC-DC power system testbed as hardware/software platform. In this system, RERs emulators together with their maximum power point tracking technology and power electronics converters were designed to test different energy harvesting algorithms. The Energy storage devices including lithium-ion batteries and ultra-capacitors were used to optimize the performance of the hybrid power system. A lithium-ion battery smart energy management system with thermal and state of charge self-balancing was proposed to protect the energy storage system. A grid connected DC PEVs parking garage emulator, with five lithium-ion batteries was also designed with the smart charging functions that can emulate the future vehicle-to-grid (V2G), vehicle-to-vehicle (V2V) and vehicle-to-house (V2H) services. This includes grid voltage and frequency regulations, spinning reserves, micro grid islanding detection and energy resource support. ^ The results show successful integration of the developed techniques for control and energy management of future hybrid AC-DC power systems with high penetration of RERs and PEVs.^

Relevância:

30.00% 30.00%

Publicador:

Resumo:

This paper presents a novel graphical approach to adjust and evaluate frequency-based relays employed in anti-islanding protection schemes of distributed synchronous generators, in order to meet the anti-islanding and abnormal frequency variation requirements, simultaneously. The proposed method defines a region in the power mismatch space, inside which the relay non-detection zone should be located, if the above-mentioned requirements must be met. Such region is called power imbalance application region. Results show that this method can help protection engineers to adjust frequency-based relays to improve the anti-islanding capability and to minimize false operation occurrences, keeping the abnormal frequency variation utility requirements satisfied. Moreover, the proposed method can be employed to coordinate different types of frequency-based relays, aiming at improving overall performance of the distributed generator frequency protection scheme. (C) 2011 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.