Comparative analysis of the expression of cytokeratins (1,10,14,16,4), involucrin, filaggrin and e-cadherin in plane warts and epidermodysplasia verruciformis plane wart-type lesions

Background: Epidermodysplasia verruciformis (EV) is a rare genodermatosis with susceptibility to human papillomavirus (HPV) infection, and high risk of skin cancer considered a model of viral oncogenesis. Methods: Fifteen cases of EV plane wart (PW)-type lesions (EV) and 14 cases of PW in healthy individuals were subjected to immunohistochemical technique for cytokeratins (K) 1, 10, 14, 16, 4, involucrin, filaggrin and e-cadherin. Results: K1/10 showed retarded or negative expression in EV, being substituted by K14. Expression of K14 occurred in the basal and suprabasal layers in both groups, but in EV, its expression was observed up to the more superficial layers. Both groups showed positivity for K16 and K4, involucrin expression in lower levels of the spinous layer and unaltered filaggrin expression. E-cadherin expression was diminished at the koilocytotic foci of both lesions, more superficially in EV. Conclusion: Infection by HPV may alter the differentiation status of the epidermis, leading to a major expression of K14, delayed or absent expression of K1/10 and earlier involucrin expression, especially in EV. It also stimulates the expression of K16 and K4. Filaggrin expression is not altered, and e-cadherin is diminished in superficial koilocytotic cells` foci in EV.

Molluscum contagiosum: immunomorphological aspects of keratinocytes markers of differentiation and adhesion

Background Molluscum contagiosum (MC) is a Molluscipox virus infection of keratinocytes with hyperplasia and intracytoplasmic inclusions-the molluscum bodies (MBs). Few papers address cytokeratins (K) profile in MC, mainly focusing terminal keratinization process. Methods Forty-one MC lesions were subjected to immunohistochemical technique to verify K1, K10, K14, K16, involucrin, filaggrin, E-cadherin and p63 expression. MC immunolabeling pattern was compared to adjacent normal appearing epidermis (ANAE). Results In MC and ANAE, K1/K10 were expressed in suprabasal layers, K14 was expressed in basal and suprabasal layers and K16 was expressed through all spinous layer. Involucrin and filaggrin were observed in granular, spinous and in basal layer of ANAE and MC. E-cadherin was present up to the first layers of MC while ANAE exhibited E-cadherin labeling at basal and spinous layers. Basal and spinous layers keratinocytes nuclei, in both MC and ANAE, express p63. Conclusion Infection by Molluscipox virus alters keratinocyte differentiation status. The presence of K14 and p63 in spinous layer, as well as early expression of involucrin and filaggrin, associated to a hyperproliferative state disclosed by K16 expression, may be a result of disruption in keratinocytes maturation process. The changes observed at ANAE may represent early events in keratinization disturbance. Callegaro CF, Sotto MN. Molluscum contagiosum: immunomorphological aspects of keratinocytes markers of differentiation and adhesion.

Relationship of adhesion molecules expression with epithelial differentiation markers during fetal skin development

Background: Cadherins and integrins are important for maintenance of tissue integrity and in signal transduction during skin development. Distribution of these molecules in human skin development was investigated and associated with markers of differentiation, cytokeratins (CK) and involucrin (INV). Methods: Using immunohistochemistry expression of E- and P-cadherins, integrins beta-1 and -4, CK10, CK14 and INV was assessed in skin fragments of 10 human fetuses (gestational weeks ranged from 4 to 24, all weighing up to 500 g). Results: At initial phases of development, integrins beta-1 and -4 and E- and P-cadherins were present on epithelial cell membranes in all layers. CK14 and CK10 were expressed in all epithelial layers and INV weakly detected in the superficial layer. In more advanced stages, integrins were detected in all layers, but a marked polarized expression was seen in basal layer. E-cadherin was detected in all layers, but the cornified stratum and P-cadherin were observed in the lower layers. CK14 was expressed in basal layer, CK10 in suprabasal stratum and INV was observed in cornified layer. Conclusions: Cadherins and integrins are essential for skin development, being spatially and temporally regulated. Their expression is related with the expression of maturation markers of the epidermis.

In vitro biocompatibility of poly(vinylidene fluoride-trifluoroethylene)/barium titanate composite using cultures of human periodontal ligament fibroblasts and keratinocytes

The mm of this work was to evaluate the biocompatibility of poly(vinylidene fluoride-trifluoroethylene)/barium titanate (P(VDF-TrFE)/BT) membrane to be used in guided tissue regeneration (GTR) Fibroblasts from human periodontal ligament (hPDLF) and keratinocytes (SCC9) were plated on P(VDF-TrFE)/BT and polytetrafluorethylene membranes at a cell density of 20.000 cells well(-1) and Cultured for up to 21 days Cell morphology, adhesion and proliferation were evaluated in hPDLF and keratinocytes, while total protein content and alkaline phosphatase (ALP) activity were assayed only for hPDLF Using a higher cell density. real-time polymerase chain reaction (PCR) was performed to assess the expression of typical genes of hPDLF, such as periostin, PDLs17, S100A4 and fibromodulin, and key phenotypic markers of keratinocytes, including involucrin, keratins 1. 10 and 14 Expression of the apoptotic genes bax, bcl-2 and Survivin was evaluated for both cultures hPDLF adhered and spread more oil P(VDF-TrFE)/BT, whereas keratinocytes showed a round shape on both membranes. hPDLF adhesion was greater oil P(VDF-TrFE)/BT at 2 and 4 h, while keratinocyte adhesion was similar for both membranes. Whereas proliferation was significantly higher for hPDLF on P(VDF-TrFE)/BT at days 1 and 7. no signs of keratinocyte proliferation could be noticed for both membranes Total protein content was greater on P(VDF-TrFE)/BT at 7, 14 and 21 days, and higher levels of ALP activity were observed oil P(VDF-TrFE)/BT at 21 days. Real-time PCR revealed higher expression of phenotypic markers of hPDLF and keratinocytes as well as greater expression of apoptotic genes in cultures grown on P(VDF-TrFE)/BT. These results indicate that, by favoring hPDLF adhesion. spreading. proliferation and typical mRNA expression, P(VDF-TrFE)/BT membrane should be considered an advantageous alternative for GTR (C) 2009 Acta Materialia Inc Published by Elsevier Ltd All rights reserved

Peroxisome-proliferator-activated receptor (PPAR)-gamma activation stimulates keratinocyte differentiation.

Previous studies demonstrated that peroxisome-proliferator-activated receptor (PPAR)-alpha or PPAR-delta activation stimulates keratinocyte differentiation, is anti-inflammatory, and improves barrier homeostasis. Here we demonstrate that treatment of cultured human keratinocytes with ciglitazone, a PPAR-gamma activator, increases involucrin and transglutaminase 1 mRNA levels. Moreover, topical treatment of hairless mice with ciglitazone or troglitazone increases loricrin, involucrin, and filaggrin expression without altering epidermal morphology. These results indicate that PPAR-gamma activation stimulates keratinocyte differentiation. Additionally, PPAR-gamma activators accelerated barrier recovery following acute disruption by either tape stripping or acetone treatment, indicating an improvement in permeability barrier homeostasis. Treatment with PPAR-gamma activators also reduced the cutaneous inflammatory response that is induced by phorbol 12-myristate-13-acetate, a model of irritant contact dermatitis and oxazolone, a model of allergic contact dermatitis. To determine whether the effects of PPAR-gamma activators are mediated by PPAR-gamma, we next examined animals deficient in PPAR-gamma. Mice with a deficiency of PPAR-gamma specifically localized to the epidermis did not display any cutaneous abnormalites on inspection, but on light microscopy there was a modest increase in epidermal thickness associated with an increase in proliferating cell nuclear antigen (PCNA) staining. Key functions of the skin including permeability barrier homeostasis, stratum corneum surface pH, and water-holding capacity, and response to inflammatory stimuli were not altered in PPAR-gamma-deficient epidermis. Although PPAR-gamma activators stimulated loricrin and filaggrin expression in wild-type animals, however, in PPAR-gamma-deficient mice no effect was observed indicating that the stimulation of differentiation by PPAR-gamma activators is mediated by PPAR-gamma. In contrast, PPAR-gamma activators inhibited inflammation in both PPAR-gamma-deficient and wild-type mouse skin, indicating that the inhibition of cutaneous inflammation by these PPAR-gamma activators does not require PPAR-gamma in keratinocytes. These observations suggest that thiazolidindiones and perhaps other PPAR-gamma activators maybe useful in the treatment of cutaneous disorders.

Las Autoridades locales como actores constructores de paz en el marco de la cooperación descentralizada

La actividad internacional de los gobiernos locales ha traído consigo nuevos debates que cuestionan a los estados como únicos representantes de las relaciones internacionales. Las tendencias actuales del sistema internacional muestran ciudades fortalecidas que han ido adquiriendo un rol cada vez más importante en la construcción del desarrollo de las naciones. Por tanto, este documento aspira contribuir al debate sobre la necesidad de que los gobiernos locales se involucren más en la construcción de paz a través de la cooperación descentralizada bajo un enfoque de reciprocidad, beneficio mutuo e interés mutuo. En síntesis, hay un interés particular por analizar las autoridades locales como actores potenciales para el fortalecimiento de una paz positiva en un contexto en el cual las estrategias de desarrollo se empiezan a pensar cada vez más desde lo local.

IRF6 is a mediator of the Notch pro-differentiation and tumour suppressive function in keratinocytes

I. Résumé large publicIRF6 est un médiateur de Notch dans la différenciation des kératinocytes et dans sa fonction de suppresseur de tumeursLa peau est l'organe le plus important du corps humain, elle représente chez l'adulte une surface d'environ 1,5 m2 et elle est composée de 2000 milliards de cellules. La peau est composée de plusieurs types cellulaires dont les kératinocvtes. Ces cellules, qui se trouvent dans la couche la plus externe de la peau (Pépiderme), nous protègent de la déshydratation et des agressions externes telles que les infections et rayons ultraviolets. Cette fonction de « barrière » est mise en place grâce à un processus appelé différenciation des kératinocvtes durant lequel les kératinocytes deviennent matures et finalement meurent pour former la couche cornée la plus externe difficilement pénétrable. L'homéostasie tissulaire est un mécanisme qui régule l'équilibre entre prolifération, différentiation et mort cellulaire. Une perturbation de cet équilibre peut mener à la formation d'une tumeur. Il existe différents types de tumeurs de la peau. Nous nous sommes intéressés aux «carcinomes spino-cellulaires» (SCC) qui se développent à partir des keratinocytes en différenciation. Notch est une molécule impliquée positivement dans la différenciation des kératinocytes et joue un rôle prépondérant dans la suppression des tumeurs kératinocytaires comme les SCC dans lesquelles Notch est faiblement exprimé. L'implication de Notch dans la différenciation et dans la carcinogenèse kératinocytaire n'est plus controversée, mais les mécanismes qui sont à la base de ces fonctions restent encore à élucider. IRfF6 est une protéine qui, d'après sa structure, a été classée parmi une famille de régulateurs de la défense de l'organisme (IRFs). Des études ultérieures ont montré qu'IRf 6 n'a pas de rôle dans la réponse immunitaire mais qu'il est plutôt impliqué dans le développement de l'épiderme. Dans ce travail, nous avons établi que, dans les kératinocytes, l'expression d'IPJF6 est contrôlé par Notch et que, comme pour ce dernier, elle est réduite dans les SCCs. De plus, nous avons observé qu'IRF6 régule les mêmes gènes que Notch, et qu'il est en effet un médiateur de la fonction de Notch dans la différenciation des kératinocytes. Parmi les gènes contrôlés par l'axe Notch-IRF6 il y en a trois qui sont sur-exprimés dans les SCCs et qui sont réprimés par cet axe. Il s'agit d'une part d'IRF3 et IRF7, deux autres membres de la famille IRF, et du récepteur EGFR (Epidermal growth factor receptor), un oncogène (un gène impliqué dans l'accélération de la formation de tumeurs). Dans leur ensemble, ces découvertes nous informent sur les mécanismes impliqués dans les fonctions pro-differentiatrice et tumeur suppressive de Notch. Plus encore, elles ouvrent des perspectives intéressantes quant au développement de nouvelles approches thérapeutiques dans le traitement des cancers.II. RésuméLa voie de signalisation de Notch joue un rôle très important dans la différenciation cellulaire et dans la carcinogenèse de nombreux tissus. Dans les kératinocytes, elle agit comme suppresseur de tumeurs, fonction altérée dans les cancers spino cellulaires SCC (tumeurs kératinocytaires) de part la perte d'expression de Notch.Bien que les fonctions pro-différenciatrice et tumeur-suppressive de la voie de signalisation de Notch soient aujourd'hui reconnues, les mécanismes sous-jacents restent à explorer.Dans ce travail, nous montrons qu'IRF6, un membre de la famille des régulateurs de la voie de l'interféron (IRF), ne possédant pas de rôles dans la réponse immunitaire mais essentiel dans le développement de l'épiderme, est d'autant plus exprimé que le kératinocytes sont différenciées alors que son expression est drastiquement diminuée dans les SCC. De façon intéressante, l'expression d'IRF6 durant la différenciation kératinocytaire est directement contrôlée par Notch.Dans les kératinocytes l'expression accrue d'IRP6 a les mêmes effets que 1'activation de la voie de Notch induisant les marqueurs de différentiation des couches supra-basales de l'épiderme et inhibant ceux de la couche basale impliqués dans la prolifération cellulaire. Cependant IRF6 n'est pas impliqué dans la régulation d'autres cibles de Notch, comme p21WAFI/CiP' et Hesl. Comme Notch, IRF6 contrôle négativement l'expression de EGFR et IRF3/7. De ce fait EGFR et IRF3 et IRF7 sont fortement exprimés dans les SCCs humaines où l'expression de Notch et IRF6 est fortement réduite.En conclusion, nous avons démontré qu'IRF6 est une cible directe de Notch/CSL dans les keratinocytes qui medie les effets "non-canonique" de cette voie de signalisation dans la différentiation et dans la suppression tumorale.III. SummaryThe Notch pathway is an important regulator of differentiation and carcinogenesis. In keratinocytes it acts as tumour suppressor and the Notch gene is markedly reduced in keratinocyte-derived squamous cell carcinoma (SCC). While the pro-differentiation and tumour suppressive functions of Notch signalling in keratinocytes are well established, the underlying mechanisms are still poorly understood, We report here that Interferon Regulatory Factor 6 (IRF6), an IRF family member with an essential role in epidermal development, is downmodulated in SCC and is induced in differentiating cells. We observed that the induction of IRF6 in differentiating keratinocytes is suppressed by Notch inhibition. IRF6 expression is also decreased in mice with keratinocyte-specific deletion of the Notch 1/2.Moreover we show that the expression of this gene is induced by Notch activation through a CSL-dependent mechanism even under conditions of protein synthesis inhibition, with endogenous Notch 1 binding to the IRF6 promoter.Increased IRJF6 expression is necessary for the impact of Notch activation on differentiation markers K1 and Involucrin, and proliferation markers integrins and p63, but not on other "canonical" Notch targets like p21WAF1/Cipl, Hes1 and Hey1. Like Notch 1, IRF6 down-modulates expression of epidermal growth factor receptor (EGFR) as well as two other IRF family members, IRF3 and 7, which we previously linked to positive control of p63 expression. Expression of IRF3, IRF7 and EGFR is enhanced in cutaneous squamous cell carcinomas, illustrating a strikingly opposite pattern compared to Notch and IRF6.Thus, IRF6 is a primary Notch target in keratinocytes, which mediates the effects of this pathway on differentiation and contributes to tumor suppression.

The δ-Opioid Receptor Affects Epidermal Homeostasis via ERK-Dependent Inhibition of Transcription Factor POU2F3.

Neuropeptides and their receptors are present in human skin, and their importance for cutaneous homeostasis and during wound healing is increasingly appreciated. However, there is currently a lack of understanding of the molecular mechanisms by which their signaling modulates keratinocyte function. Here, we show that δ-opioid receptor (DOPr) activation inhibits proliferation of human keratinocytes, resulting in decreased epidermal thickness in an organotypic skin model. DOPr signaling markedly delayed induction of keratin intermediate filament (KRT10) during in vitro differentiation and abolished its induction in the organotypic skin model. This was accompanied by deregulation of involucrin (IVL), loricrin, and filaggrin. Analysis of the transcription factor POU2F3, which is involved in regulation of KRT10, IVL, and profilaggrin expression, revealed a DOPr-mediated extracellular signal-regulated kinase (ERK)-dependent downregulation of this factor. We propose that DOPr signaling specifically activates the ERK 1/2 mitogen-activated protein kinase pathway to regulate keratinocyte functions. Complementing our earlier studies in DOPr-deficient mice, these data suggest that DOPr activation in human keratinocytes profoundly influences epidermal morphogenesis and homeostasis.

The role of the δ-opioid receptor in skin homeostasis and wound healing

Au regard des agressions environnementales constantes que la peau doit endurer, l'équilibre fragile entre l'expression et la répression des gènes épidermiques, nécessaire à la différentiation et la prolifération des kératinocytes, pourrait facilement être perturbé en l'absence des mécanismes de stabilisation robustes. La présence d'un système neuroendocrinien local est donc importante afin de coordonner une réponse aux éventuelles irritations. En effet, l'expression de plusieurs neurohormones, des neurotransmetteurs et des neuropeptides, y compris des dérivés pro-opiomélanocortine comme la ß-endorphine et [Met5]-enképhaline, ainsi que l'expression du récepteur 8-opioïde (DOR) a été démontré dans la peau. Cependant, les mécanismes moléculaires par lesquels ils modulent la fonction des kératinocytes sont mal connus. Le présent travail démontre que la voie de signalisation DOR active spécifiquement la voie ERK 1/2 MAPK dans les lignées cellulaires de kératinocytes humains, inhibant la prolifération des cellules et entraîne une diminution de l'épaisseur épidermique dans un modèle organotypique de peau. De plus, l'expression de DOR retarde nettement l'induction de la kératine 10 (KRT 10) et la kératine 1 (KRT 1) dans une modèle 2D de différentiation in vitro, et supprime l'induction de KRT 10 dans un modèle organotypique de peau. Ceci est accompagné de la dérégulation de l'involucrine (IVL), la loricrine (LOR) et la fïlaggrin (FLG), résultant en une induction nettement réduite de leur expression lors de l'initiation de la différentiation in vitro. De plus, POU2F3 a été identifié comme un facteur de transcription régulant les gènes de différentiation des kératinocytes modulés par DOR. Il a été démontré que la régulation négative de POU2F3 via la voie DOR-ERK affecte les principaux aspects de la fonction des kératinocytes. Toutefois, il est évident que des facteurs supplémentaires influencent la fonctionnalité de la voie DOR elle-même. Le calcium et le contact cellule-cellule augmentent la quantité des récepteurs à la surface cellulaire des kératinocytes. Les kératinocytes dont les récepteurs sont internalisés ne répondent pas de la même manière que ceux possédant des récepteurs fonctionnels localisée à la membrane. Ce travail suggère que lors de signaux intrinsèques ou extrinsèques spécifiques, les kératinocytes sont capable de répondre via le système opioïdergique neuro-epidermique. Cette réponse doit être spatialement et temporairement contrôlée afin d'éviter un déséquilibre de l'homéostasie épidermique et un retard de cicatrisation. La compréhension de ce processus très complexe pourrait permettre à terme le développement de meilleurs traitements des affections cutanées pathologiques. En complément des études précédentes sur des souris DOR-défïcientes, ces données suggèrent que l'activation de DOR dans les kératinocytes humains influence la morphogenèse et l'homéostasie de l'épiderme, et pourrait jouer un rôle lors du processus de cicatrisation. - In view of the constant environmental assaults that the skin must endure, the delicate balance of an eloquent sequence of epidermal gene expression and repression, that is required for appropriate differentiation and proliferation of keratinocytes, might easily become derailed in the absence of robust stabilizing mechanisms. The presence of a local neuroendocrine system is thereby important to coordinate a response towards irritations. In fact, the expression of several neurohormones, neurotransmitters, and neuropeptides, including proopiomelanocortin derivatives, such as ß- endorphin and [Met5]-enkephalin has been shown in skin, as well as expression of the 6-opioid receptor (DOR). However, there is currently a lack of understanding of the molecular mechanisms by which their signalling modulates keratinocyte function. The present work demonstrates that DOR signalling specifically activates the ERK 1/2 MAPK pathway in human keratinocyte cell lines. This activation inhibits cell proliferation, resulting in decreased epidermal thickness in an organotypic skin model. Furthermore, DOR expression markedly delays induction of keratin intermediate filament Keratin 10 (KRT 10) and KRT 1 during in vitro differentiation, and abolishes the induction of KRT 10 in the organotypic skin model. This is accompanied by deregulation of involucrin (IVL), loricrin (LOR), and filaggrin (FLG), illustrated by a markedly reduced induction of their expression upon initiation of differentiation in vitro. Additionally, POU2F3 was identified as a transcription factor mediating the DOR induced regulation of keratinocyte differentiation related genes. It was revealed that DOR-mediated ERK-dependent downregulation of this factor affects key aspects of keratinocyte function. However, it is evident that additional triggers influence the functionality of the DOR itself. Calcium at concentrations above 0.1 mM and cell-cell contact both enhance the presence of receptor molecules on the keratinocytes cell surface. Keratinocytes with internalized receptor do not respond to DOR ligands in the same way as keratinocytes with a functional membrane localized receptor.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Iron-regulated surface determinant protein a mediates adhesion of staphylococcus aureus to human corneocyte envelope proteins

The ability of Staphylococcus aureus to colonize the human nares is a crucial prerequisite for disease. IsdA is a major S. aureus surface protein that is expressed during human infection and required for nasal colonization and survival on human skin. In this work, we show that IsdA binds to involucrin, loricrin, and cytokeratin K10, proteins that are present in the cornified envelope of human desquamated epithelial cells. To measure the forces and dynamics of the interaction between IsdA and loricrin (the most abundant protein of the cornified envelope), single-molecule force spectroscopy was used, demonstrating high-specificity binding. IsdA acts as a cellular adhesin to the human ligands, promoting whole-cell binding to immobilized proteins, even in the absence of other S. aureus components (as shown by heterologous expression in Lactococcus lactis). Inhibition experiments revealed the binding of the human ligands to the same IsdA region. This region was mapped to the NEAT domain of IsdA. The NEAT domain also was found to be required for S. aureus whole-cell binding to the ligands as well as to human nasal cells. Thus, IsdA is an important adhesin to human ligands, which predominate in its primary ecological niche.

Expression of differential genes involved in the maintenance of water balance in human skin by Piptadenia colubrina extract

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

In vitro biocompatibility of poly(vinylidene fluoride-trifluoroethylene)/barium titanate composite using cultures of human periodontal ligament fibroblasts and keratinocytes

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Estudo do efeito do extrato hidroglicólico de Bidens pilosa na expressão de genes relacionados à intergridade da pele

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Immunocytochemistry associated with oral exfoliative cytology methodological analysis

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)