In vitro photodynamic therapy on human oral keratinocytes using chloroaluminum-phthalocyanine

In this study, oral carcinoma cells were used to evaluate chloroaluminum-phthalocyanine encapsulated in liposomes as the photosensitizer agent in support of photodynamic therapy (PDT). The genotoxicity and cytotoxicity behavior of the encapsulated photosensitizer in both dark and under irradiation using the 670-nm laser were investigated with the classical trypan blue cell viability test, the acridine orange/ethidium bromide staining organelles test, micronucleus formation frequency, DNA fragmentation, and cell morphology. The cell morphology investigation was carried out using light and electronic microscopes. Our findings after PDT include reduction in cell viability (95%) associated with morphologic alterations. The neoplastic cell destruction was predominantly started by a necrotic process, according to the assay with acridine orange and ethidium bromide, and this was confirmed by electronic microscopy analysis. Neither the PDT agent nor laser irradiation alone showed cytotoxicity, genotoxicity, or even morphologic alterations. Our results reinforce the efficiency of tight-irradiated chloroaluminum-phthalocyanine in inducing a positive effect of PDT. (C) 2008 Elsevier Ltd. All rights reserved.

EPIDERMAL GROWTH-FACTOR AND TRANSFORMING GROWTH-FACTOR-ALPHA CHARACTERISTICS OF HUMAN ORAL-CARCINOMA CELL-LINES

This study examined the expression of epidermal growth factor (EGF) cell-surface receptors, the response to exogenous ligand and the autocrine production of transforming growth factor a (TGF-a) in normal and carcinoma-derived human oral keratinocytes. One of eight malignant cell lines overexpressed EGF receptors, while the remainder expressed receptor numbers similar to normal cells. Exogenous EGF stimulated incorporation of tritiated thymidine in a dose-dependent manner. In keratinocytes expressing normal numbers of EGF receptors, the cellular response to exogenous EGF correlated positively with total EGF receptor number. SCC-derived keratinocytes produced more TGF-a than normal cells. There was no statistical correlation between the autocrine production of TGF-a, EGF cell-surface receptor expression and cellular response to exogenous EGF. While the growth-stimulatory effects of exogenous TGF-cl were inhibited by the addition of a neutralising antibody, the presence of this antibody in conditioned medium failed to produce a similar decrease in growth. The results indicate that overexpression of EGF receptors is not an invariable characteristic of human oral squamous carcinoma-derived cell lines. Further, the contribution of TGF-a to the growth of normal and carcinoma-derived human oral keratinocytes in vitro may be less significant than previously documented.

Is it safe to utilize in vitro reconstituted human oral epithelium? An oncogenetic pathway study

Cell therapy is a therapeutic strategy used to replace or repair damaged tissue. The epithelium transplantation of cultivated keratinocytes has been applied to several modalities of reconstruction, like oral, urethra and ocular surface. Life and death signals work coordinately to ensure cellular quality control and the viability of an organism. The aim of this study is to verify that culture conditions did not induce genetic mutations through the analysis of the key genes: pAKT, Pten, p53 and MDM2 and investigate the presence of the related proteins in human oral keratinocytes obtained by primary culture and in vitro cultivated. Formalin fixed and paraffin embedded tissues from the oral cavity were utilized as control for normal expression of the related markers and two oral squamous cell carcinoma cell lines provided the expression pattern of the proposed markers in the event of cellular transformation. Akt, PTEN, p53 and MDM2 immunohistochemistry and Western-Blotting analyzes were performed. The results showed the expression levels and intracellular localizations of the four proteins evaluated. These analyzes confirmed that the produced in vitro epithelium is bio-compatible for its utilization as reconstruction and reparatory tissue, however further analyses and additional research on other biomarkers should be performed to analyse the long term engraftment of transplantable primary culture of oral keratinocytes and the long term resistance to cellular transformation.

Comparison of two cellular harvesting methods for primary human oral culture of keratinocytes

The possibility of obtaining transplantable oral epithelia opens new perspectives for oral treatments. Most of them are surgical, resulting in mucosal failures. As reconstructive material this in vitro epithelia would be also useful for other parts of the human body. Many researchers still use controversial methods; therefore it was evaluated and compared the efficiency of the enzymatic and direct explant methods to obtain oral keratinocytes. To this project oral epithelia fragments were used. This work compared: time needed for cell obtainment, best cell amount, life-span and epithelia forming cell capacity. The results showed the possibility to obtain keratinocytes from a small oral fragment and we could verify the advantages and peculiar restrictions. We concluded that under our conditions the enzymatic method showed the best results: in the cells obtaining time needed, cell amount and life-span. Both methods showed the same capacity to form in vitro epithelia.

Histological and histochemical evaluation of human oral mucosa constructs developed by tissue engineering

Reconstruction of large oral mucosa defects is often challenging, since the shortage of healthy oral mucosa to replace the excised tissues is very common. In this context, tissue engineering techniques may provide a source of autologous tissues available for transplant in these patients. In this work, we developed a new model of artificial oral mucosa generated by tissue engineering using a fibrin-agarose scaffold. For that purpose, we generated primary cultures of human oral mucosa fibroblasts and keratinocytes from small biopsies of normal oral mucosa using enzymatic treatments. Then we determined the viability of the cultured cells by electron probe quantitative X-ray microanalysis, and we demonstrated that most of the cells in the primary cultures were alive and had high K/Na ratios. Once cell viability was determined, we used the cultured fibroblasts and keratinocytes to develop an artificial oral mucosa construct by using a fibrin-agarose extracellular matrix and a sequential culture technique using porous culture inserts. Histological analysis of the artificial tissues showed high similarities with normal oral mucosa controls. The epithelium of the oral substitutes had several layers, with desmosomes and apical microvilli and microplicae. Both the controls and the oral mucosa substitutes showed high suprabasal expression of cytokeratin 13 and low expression of cytokeratin 10. All these results suggest that our model of oral mucosa using fibrin-agarose scaffolds show several similarities with native human oral mucosa.

Porphyromonas gingivalis LPS stimulation downregulates DNMT1, DNMT3a, and JMJD3 gene expression levels in human HaCaT keratinocytes

Objective: The role of epigenetic regulation in inflammatory diseases such as periodontitis is poorly known. The aim of this study was to assess whether Porphyromonas gingivalis lipopolysaccharide (LPS) can modulate gene expression levels of the some enzymes that promote epigenetic events in cultures of the human keratinocytes and gingival fibroblasts. In addition, the same enzymes were evaluated in gingival samples from healthy and periodontitis-affected individuals. Materials and methods: Primary gingival fibroblast and keratinocyte (HaCaT) cultures were treated with medium containing P. gingivalis LPS or P. gingivalis LPS vehicle for 24 h. After this period, cell viability was assessed by MTT test and total RNA extracted to evaluate gene expression levels of the following enzymes by qRT-PCR: DNA methyltransferase 1 (DNMT1), DNA methyltransferase 3a (DNMT3a), histone demethylases Jumonji domain containing 3 (JMJD3) and ubiquitously transcribed tetratricopeptide repeat, X chromosome (UTX). To evaluate gene expression in healthy and periodontitis-affected individuals, total RNA was extracted from biopsies of gingival tissue from healthy and periodontitis sites, and gene expression of DNMT1, DNAMT3a, JMJD3, and UTX was evaluated by qRT-PCR. Results: No significant differences were found in the gene expression analysis between healthy and periodontitis-affected gingival samples. The results showed that LPS downregulated DNMT1 (p < 0. 05), DNMT3a (p < 0. 05), and JMJD3 (p < 0. 01) gene expression in HaCaT cells, but no modulation was observed in gingival fibroblasts. Conclusion: P. gingivalis LPS exposure to human HaCaT keratinocytes downregulates gene expression of the enzymes that promote epigenetic events. Clinical relevance: The advance knowledge about epigenetic modifications caused by periodontopathogens may to possibly led to the development of new periodontal therapies. © 2012 Springer-Verlag.

E2F-1 induces proliferation-specific genes and suppresses squamous differentiation-specific genes in human epidermal keratinocytes

Squamous differentiation of keratinocytes is associated with decreases in E2F-1 mRNA expression and E2F activity, and these processes are disrupted in squamous cell carcinoma cell lines. We now show that E2F-1 mRNA expression is increased in primary squamous cell carcinomas of the skin relative to normal epidermis, To explore the relationship between E2F-1 and squamous differentiation further, we examined the effect of altering E2F activity in primary human keratinocytes induced to differentiate. Promoter activity for the proliferation-associated genes, cdc2 and keratin 14, are inhibited during squamous differentiation. This inhibition can be inhibited by overexpression of E2F-1 in keratinocytes, Overexpression of E2F-1 also suppressed the expression of differentiation markers (transglutaminase type 1 and keratin 10) in differentiated keratinocytes, Blocking E2F activity by transfecting proliferating keratinocytes with dominant negative E2F-1 constructs inhibited the expression of cdc2 and E2F-1, but did not induce differentiation. Furthermore, expression of the dominant negative construct in epithelial carcinoma cell lines and normal keratinocytes decreased expression from the cdc2 promoter. These data indicate that E2F-1 promotes keratinocyte proliferation-specific marker genes and suppresses squamous differentiation-specific marker genes. Moreover, these data indicate that targeted disruption of E2F-1 activity may have therapeutic potential for the treatment of squamous carcinomas.

Effect of low-intensity laser therapy on mast cell degranulation in human oral mucosa

Little is known about the physiological mechanisms related to low-intensity laser therapy (LILT), particularly in acute inflammation and subsequent wound healing. The objective of this study was to verify the effect of LILT on mast cell degranulation. Epulis fissuratum tissues from eight patients were used. One part of the lesion was irradiated with an AsGaAl laser (lambda = 670 nm, 8.0 J/cm(2), 5 mW, 4 min). The other part was not irradiated. Then, the specimens were immediately removed, fixed and examined by light microscopy. The number of mast cells was similar in laser-treated samples when compared with non-irradiated specimens. The degranulation indexes of the mast cells observed in the irradiated samples were significantly higher than those of controls (P < 0.05). LILT with the parameters used increased the number of degranulated mast cells in oral mucosa.

The relevance of bacterial interactions on oral health

Dissertação de mestrado integrado em Engenharia Biomédica (área de especialização em Engenharia Clínica)

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Laminin-derived peptide AG73 regulates migration, invasion, and protease activity of human oral squamous cell carcinoma cells through syndecan-1 and beta 1 integrin

Squamous cell carcinoma is a prevalent head and neck tumor with high mortality. We studied the role played by laminin alpha 1 chain peptide AG73 on migration, invasion, and protease activity of cells (OSCC) from human oral squamous cell carcinoma. Immunohistochemistry and immunofluorescence analyzed expression of laminin alpha 1 chain and MMP9 in oral squamous cells carcinoma in vivo and in vitro. Migratory activity of AG73-treated OSCC cells was investigated by monolayer wound assays and in chemotaxis chambers. AG73-induced invasion was assessed in Boyden chambers. Invasion depends on MMPs. Conditioned media from cells grown on AG73 was subjected to zymography. We searched for AG73 receptors related to these activities in OSCC cells. Immunofluorescence analyzed AG73induced colocalization of syndecan-1 and beta 1 integrin. Cells had these receptors silenced by siRNA, followed by treatment with AG73 and analysis of migration, invasion, and protease activity. Oral squamous cell carcinoma expresses laminin alpha 1 chain and MMP9. OSCC cells treated with AG73 showed increased migration, invasion, and protease activity. AG73 induced colocalization of syndecan-1 and beta 1 integrin. Knockdown of these receptors decreased AG73-dependent migration, invasion, and protease activity. Syndecan-1 and beta 1 integrin signaling downstream of AG73 regulate migration, invasion, and MMP production by OSCC cells.

Stress hormones increase cell proliferation and regulates interleukin-6 secretion in human oral squamous cell carcinoma cells

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)