Analyses of six homologous proteins of Protochlamydia amoebophila UWE25 encoded by large GC-rich genes (lgr): a model of evolution and concatenation of leucine-rich repeats.

BACKGROUND: Along the chromosome of the obligate intracellular bacteria Protochlamydia amoebophila UWE25, we recently described a genomic island Pam100G. It contains a tra unit likely involved in conjugative DNA transfer and lgrE, a 5.6-kb gene similar to five others of P. amoebophila: lgrA to lgrD, lgrF. We describe here the structure, regulation and evolution of these proteins termed LGRs since encoded by "Large G+C-Rich" genes. RESULTS: No homologs to the whole protein sequence of LGRs were found in other organisms. Phylogenetic analyses suggest that serial duplications producing the six LGRs occurred relatively recently and nucleotide usage analyses show that lgrB, lgrE and lgrF were relocated on the chromosome. The C-terminal part of LGRs is homologous to Leucine-Rich Repeats domains (LRRs). Defined by a cumulative alignment score, the 5 to 18 concatenated octacosapeptidic (28-meric) LRRs of LGRs present all a predicted alpha-helix conformation. Their closest homologs are the 28-residue RI-like LRRs of mammalian NODs and the 24-meres of some Ralstonia and Legionella proteins. Interestingly, lgrE, which is present on Pam100G like the tra operon, exhibits Pfam domains related to DNA metabolism. CONCLUSION: Comparison of the LRRs, enable us to propose a parsimonious evolutionary scenario of these domains driven by adjacent concatenations of LRRs. Our model established on bacterial LRRs can be challenged in eucaryotic proteins carrying less conserved LRRs, such as NOD proteins and Toll-like receptors.

Contribution of AT-, GC-, and methylated cytidine-rich DNA to chromatin composition in Malpighian tubule cell nuclei of Panstrongylus megistus (Hemiptera, Reduviidae)

The Malpighian tubule cell nuclei of male Panstrongylus megistus, a vector of Chagas disease, contain one chromocenter, which is composed solely of the Y chromosome. Considering that different chromosomes contribute to the composition of chromocenters in different triatomini species, the aim of this study was to determine the contribution of AT-, GC-, and methylated cytidine-rich DNA in the chromocenter as well as in euchromatin of Malpighian tubule cell nuclei of P. megistus in comparison with published data for Triatoma infestans. Staining with 4',6-diamidino-2-phenylindole/actinomycin D and chromomycin A(3)/distamycin, immunodetection of 5-methylcytidine and AgNOR test were used. The results revealed AT-rich/GC-poor DNA in the male chromocenter, but equally distributed AT and GC DNA sequences in male and female euchromatin, like in T. infestans. Accumulation of argyrophilic proteins encircling the chromocenter did not always correlate with that of GC-rich DNA. Methylated DNA identified by immunodetection was found sparsely distributed in the euchromatin of both sexes and at some points around the chromocenter edge, but it could not be considered responsible for chromatin condensation in the chromocenter, like in T. infestans. However, unlike in T. infestans, no correlation between the chromocenter AT-rich DNA and nucleolus organizing region (NOR) DNA was found in P. megistus. (c) 2011 Elsevier GmbH. All rights reserved.

Specific binding of the mammalian high mobility group protein AT-hook 2 to the minor groove of AT -rich DNAs: Thermodynamic and specificity studies

The mammalian high mobility group protein AT-hook 2 (HMGA2) is a small transcriptional factor involved in cell development and oncogenesis. It contains three "AT-hook" DNA binding domains, which specifically recognize the minor groove of AT-rich DNA sequences. It also has an acidic C-terminal motif. Previous studies showed that HMGA2 mediates all its biological effects through interactions with AT-rich DNA sequences in the promoter regions. In this dissertation, I used a variety of biochemical and biophysical methods to examine the physical properties of HMGA2 and to further investigate HMGA2's interactions with AT-rich DNA sequences. The following are three avenues perused in this study: (1) due to the asymmetrical charge distribution of HMGA2, I have developed a rapid procedure to purify HMGA2 in the milligram range. Preparation of large amounts of HMGA2 makes biophysical studies possible; (2) Since HMGA2 binds to different AT-rich sequences in the promoter regions, I used a combination of isothermal titration calorimetry (ITC) and DNA UV melting experiment to characterize interactions of HMGA2 with poly(dA-dT) 2 and poly(dA)poly(dT). My results demonstrated that (i) each HMGA2 molecule binds to 15 AT bp; (ii) HMGA2 binds to both AT DNAs with very high affinity. However, the binding reaction of HMGA2 to poly(dA-dT) 2 is enthalpy-driven and the binding reaction of HMGA2 with poly(dA)poly(dT) is entropy-driven; (iii) the binding reactions are strongly depended on salt concentrations; (3) Previous studies showed that HMGA2 may have sequence specificity. In this study, I used a PCR-based SELEX procedure to examine the DNA binding specificity of HMGA2. Two consensus sequences for HMGA2 have been identified: 5'-ATATTCGCGAWWATT-3' and 5'-ATATTGCGCAWWATT-3', where W represents A or T. These consensus sequences have a unique feature: the first five base pairs are AT-rich, the middle four to five base pairs are GC-rich, and the last five to six base pairs are AT-rich. All three segments are critical for high affinity binding. Replacing either one of the AT-rich sequences to a non-AT-rich sequence causes at least 100-fold decrease in the binding affinity. Intriguingly, if the GC-segment is substituted by an AT-rich segment, the binding affinity of HMGA2 is reduced approximately 5-fold. Identification of the consensus sequences for HMGA2 represents an important step towards finding its binding sites within the genome.

Unlocking hidden genomic sequence

Despite the success of conventional Sanger sequencing, significant regions of many genomes still present major obstacles to sequencing. Here we propose a novel approach with the potential to alleviate a wide range of sequencing difficulties. The technique involves extracting target DNA sequence from variants generated by introduction of random mutations. The introduction of mutations does not destroy original sequence information, but distributes it amongst multiple variants. Some of these variants lack problematic features of the target and are more amenable to conventional sequencing. The technique has been successfully demonstrated with mutation levels up to an average 18% base substitution and has been used to read previously intractable poly(A), AT-rich and GC-rich motifs.

The sequence of a 200 kb portion of a Plasmodium vivax chromosome reveals a high degree of conservation with Plasmodium falciparum chromosome 3

Within a 199 866 base pair (bp) portion of a Plasmodium vivax chromosome we identified a conserved linkage group consisting of at least 41 genes homologous to Plasmodium falciparum genes located on chromosome 3. There were no P. vivax homologues of the P. falciparum cytoadherence-linked asexual genes clag 3.2, clag 3.1 and a var C pseudogene found on the P. vivax chromosome. Within the conserved linkage group, the gene order and structure are identical to those of P. falciparum chromosome 3. This conserved linkage group may extend to as many as 190 genes. The subtelomeric regions are different in size and the P. vivax segment contains genes for which no P. falciparum homologues have been identified to date. The size difference of at least 900 kb between the homologous P. vivax chromosome and P. falciparum chromosome 3 is presumably due to a translocation. There is substantial sequence divergence with a much higher guanine + cytosine (G + C) content in the DNA and a preference for amino acids using GC-rich codons in the deduced proteins of P. vivax. This structural conservation of homologous genes and their products combined with sequence divergence at the nucleotide level makes the P. vivax genome a powerful tool for comparative analyses of Plasmodium genomes. (C) 2001 Elsevier Science B.V. All rights reserved.

neptune, a Kruppel-like transcription factor that participates in primitive erythropoiesis in Xenopus

The specification of the erythroid lineage from hematopoietic stem cells requires the expression and activity of lineage-specific transcription factors. One transcription factor family that has several members involved in hematopoiesis is the Kruppel-like factor (KLF) family [1]. For example, erythroid KLF (EKLF) regulates beta -globin expression during erythroid differentiation [2-6]. KLFs share a highly conserved zinc finger-based DNA binding domain (DBD) that mediates binding to CACCC-box and GC-rich sites, both of which are frequently found in the promoters of hematopoietic genes. Here, we identified a novel Xenopus KLF gene, neptune, which is highly expressed in the ventral blood island (VBI), cranial ganglia, and hatching and cement glands. neptune expression is induced in response to components of the BMP-4 signaling pathway in injected animal cap explants. Similar to its family member, EKLF, Neptune can bind CACCC-box and GC-rich DNA elements. We show that Neptune cooperates with the hematopoietic transcription factor XGATA-1 to enhance globin induction in animal cap explants. A fusion protein comprised of Neptune's DBD and the Drosophila engrailed repressor domain suppresses the induction of globin in ventral marginal zones and in animal caps. These studies demonstrate that Neptune is a positive regulator of primitive erythropoiesis in Xenopus.

Prolactin-releasing peptide in ewe: cDNA cloning, mRNA distribution and effects on prolactin secretion in vitro and in vivo

RT-PCR followed by 5'- and 3'- rapid amplification of cDNA ends was used to clone and sequence ovine prolactin-releasing peptide (PrRP). The cDNA was characterised by short 5'- and 3'-untranslated regions and a GC-rich (71%) coding region. The nucleotide and deduced amino acid sequences for the coding region showed 95.6 and 94.9% identity with bovine PrRP but the amino acid sequence of PrRP31 was conserved between these species. Northern blot analysis and RT-PCR showed that, as in the rat, the peptide was more abundantly expressed in the brainstem than the hypothalamus. However, in the ovine hypothalamus, PrRP mRNA expression was more widespread than in the rat, with expression detected in both rostral and caudal parts of the mediobasal hypothalamus. The effects of synthetic ovine PrRP on prolactin secretion both in vitro and in vivo were also examined. In primary cultures of sheep pituitary cells, PrRP significantly (P

Structured RNAs in the ENCODE selected regions of the human genome.

Functional RNA structures play an important role both in the context of noncoding RNA transcripts as well as regulatory elements in mRNAs. Here we present a computational study to detect functional RNA structures within the ENCODE regions of the human genome. Since structural RNAs in general lack characteristic signals in primary sequence, comparative approaches evaluating evolutionary conservation of structures are most promising. We have used three recently introduced programs based on either phylogenetic-stochastic context-free grammar (EvoFold) or energy directed folding (RNAz and AlifoldZ), yielding several thousand candidate structures (corresponding to approximately 2.7% of the ENCODE regions). EvoFold has its highest sensitivity in highly conserved and relatively AU-rich regions, while RNAz favors slightly GC-rich regions, resulting in a relatively small overlap between methods. Comparison with the GENCODE annotation points to functional RNAs in all genomic contexts, with a slightly increased density in 3'-UTRs. While we estimate a significant false discovery rate of approximately 50%-70% many of the predictions can be further substantiated by additional criteria: 248 loci are predicted by both RNAz and EvoFold, and an additional 239 RNAz or EvoFold predictions are supported by the (more stringent) AlifoldZ algorithm. Five hundred seventy RNAz structure predictions fall into regions that show signs of selection pressure also on the sequence level (i.e., conserved elements). More than 700 predictions overlap with noncoding transcripts detected by oligonucleotide tiling arrays. One hundred seventy-five selected candidates were tested by RT-PCR in six tissues, and expression could be verified in 43 cases (24.6%).

An mRNA region of the canine distemper virus fusion protein gene lacking AUG codons can promote protein expression.

Canine distemper virus (CDV) produces a glycosylated type I fusion protein (F) with an internal hydrophobic signal sequence beginning around 115 residues downstream of the first AUG used for translation initiation. Cleavage of the signal sequence yields the F0 molecule, which is cleaved into the F1 and F2 subunits. Surprisingly, when all in-frame AUGs located in the first third of the F gene were mutated a protein of the same molecular size as the F0 molecule was still expressed from both the Onderstepoort (OP) and A75/17-CDV F genes. We designated this protein, which is initiated from a non-AUG codon protein Fx. Site-directed mutagenesis allowed to identify codon 85, a GCC codon coding for alanine, as the most likely position from which translation initiation of Fx occurs in OP-CDV. Deletion analysis demonstrated that at least 60 nucleotides upstream of the GCC codon are required for efficient Fx translation. This sequence is GC-rich, suggesting extensive folding. Secondary structure may therefore be important for translation initiation at codon 85.

Differential control of Notch1 gene transcription by Klf4 and Sp3 transcription factors in normal versus cancer-derived keratinocytes.

In specific cell types like keratinocytes, Notch signaling plays an important pro-differentiation and tumor suppressing function, with down-modulation of the Notch1 gene being associated with cancer development. Besides being controlled by p53, little else is known on regulation of Notch1 gene expression in this context. We report here that transcription of this gene is driven by a TATA-less "sharp peak" promoter and that the minimal functional region of this promoter, which extends from the -342 bp position to the initiation codon, is differentially active in normal versus cancer cells. This GC rich region lacks p53 binding sites, but binds Klf4 and Sp3. This finding is likely to be of biological significance, as Klf4 and, to a lesser extent, Sp3 are up-regulated in a number of cancer cells where Notch1 expression is down-modulated, and Klf4 over-expression in normal cells is sufficient to down-modulate Notch1 gene transcription. The combined knock-down of Klf4 and Sp3 was necessary for the reverse effect of increasing Notch1 transcription, consistent with the two factors exerting an overlapping repressor function through their binding to the Notch1 promoter.

Structured RNAs in the ENCODE selected regions of the human genome

Functional RNA structures play an important role both in the context of noncoding RNA transcripts as well as regulatory elements in mRNAs. Here we present a computational study to detect functional RNA structures within the ENCODE regions of the human genome. Since structural RNAs in general lack characteristic signals in primary sequence, comparative approaches evaluating evolutionary conservation of structures are most promising. We have used three recently introduced programs based on either phylogenetic–stochastic context-free grammar (EvoFold) or energy directed folding (RNAz and AlifoldZ), yielding several thousand candidate structures (corresponding to ∼2.7% of the ENCODE regions). EvoFold has its highest sensitivity in highly conserved and relatively AU-rich regions, while RNAz favors slightly GC-rich regions, resulting in a relatively small overlap between methods. Comparison with the GENCODE annotation points to functional RNAs in all genomic contexts, with a slightly increased density in 3′-UTRs. While we estimate a significant false discovery rate of ∼50%–70% many of the predictions can be further substantiated by additional criteria: 248 loci are predicted by both RNAz and EvoFold, and an additional 239 RNAz or EvoFold predictions are supported by the (more stringent) AlifoldZ algorithm. Five hundred seventy RNAz structure predictions fall into regions that show signs of selection pressure also on the sequence level (i.e., conserved elements). More than 700 predictions overlap with noncoding transcripts detected by oligonucleotide tiling arrays. One hundred seventy-five selected candidates were tested by RT-PCR in six tissues, and expression could be verified in 43 cases (24.6%).

Transcriptional control of the Notch1 tumour suppressor gene

Abstract : The Notch pathway is an important regulator of differentiation and carcinogenesis. In keratinocytes and possibly other specific epithelial cell types, it acts as tumour suppressor. Expression of endogenous Notch1 gene is markedly reduced in keratinocyte-derived squamous cell carcinoma (SCC) and cervical cancer cells, as well as in prostate cancer cell lines, and this difference is, at least in part, at the transcriptional level. Little is known on transcriptional control of the Notch1 gene with the exception that it is a p53-target. Our work focused on the mechanisms involved in the different transcription level of the Notch1 gene in normal versus cancer cells. We show that the fully active minimal Notch1 promoter is differentially controlled in normal versus cancer cells. It consists of two distinct regions, one downstream of the transcription start site, which is likely to bind the basic transcription apparatus, and one upstream region characterized by highly GC-rich sequence. This latter region binds Sp/KLF family members, specifically Spa and KLF4, which is upregulated in cancer cells. This is functionally significant as KLF4 overexpression is sufficient to downmodulate Notchl gene transcription, while KLF4 knockdown, in combination with Spa, results in Notch1 upregulation. Control of Notch1 by KLF4/Sp3 is independent of p53. Biochemically, KLF4/Sp3 seem to affect preferentially the initiation step of Notch1 gene transcription, while p53 controls both initiation and elongation steps. Thus, the Notch1 gene is a negative Sp3/KLF4-target and this mechanism contributes, in parallel with p53, to Notch1 downregulation in cancer. Résumé : La voie de signalisation induite par Notch est considérablement impliquée dans la différenciation des cellules et dans la carcinogénèse. Dans les kératinocytes ainsi que dans d'autres types cellulaires de l'épithelium, il agit comme suppresseur de tumeur. L'expression endogène de Notch1 est remarquablement réduite dans les cellules du carcinome spino-cellulaire et du cancer du col de l'utérus ou dans les lignées cellulaires du cancer de la prostate. Cette différence s'explique, du moins en partie, par le niveau de transcription. Peu de choses sont connues sur le contrôle transcriptionnel de Notch1 à l'exception du fait qu'il soit une cible de p53. Notre travail s'est concentré sur les mécanismes impliqués dans la transcription de Notch1, mécanismes qui diffèrent entre les cellules normales et les cellules cancéreuses. Nous avons trouvé la plus petite région du promoteur de Notch1 qui est suffisante pour induire un haut niveau transcriptionnel et qui est contrôlée différemment dans les cellules normales et les cellules cancéreuses. Elle est constituée de deux régions distinctes: une en aval du site de départ de la transcription, qui lie probablement le complexe de base pour la transcription, et une en amont caractérisée par une séquence riche en GC. Cette région lie les membres de la famille Sp/KLF, spécifiquement Sp3 et KLF4, qui sont surexprimés dans les cellules cancéreuses. Ceci est fonctionnellement significatif car la surexpression de KLF4 dans les kératinocytes est suffisante pour diminuer la transcription de Notch1, alors que l'inhibition de KLF4 et de Spa, résulte en une augmentation de Notch1. En outre, le contrôle de Notch1 par KLF4 et Spa est indépendant de p53. Biochimiquement, KLF4 et Spa semblent plutôt affecter l'initiation de la transcription de Notch1 alors que p53 contrôle aussi bien l'initiation que l'élongation. En conclusion, le gène Notch1 est inhibé par Spa et KLF4: ce mécanisme contribue, en parallèle à p53, à diminuer l'expression de Notch1 dans les cellules cancéreuses.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Complete DNA sequence of Kuraishia capsulata illustrates novel genomic features among budding yeasts (Saccharomycotina)

The numerous yeast genome sequences presently available provide a rich source of information for functional as well as evolutionary genomics but unequally cover the large phylogenetic diversity of extant yeasts. We present here the complete sequence of the nuclear genome of the haploid-type strain of Kuraishia capsulata (CBS1993(T)), a nitrate-assimilating Saccharomycetales of uncertain taxonomy, isolated from tunnels of insect larvae underneath coniferous barks and characterized by its copious production of extracellular polysaccharides. The sequence is composed of seven scaffolds, one per chromosome, totaling 11.4 Mb and containing 6,029 protein-coding genes, ~13.5% of which being interrupted by introns. This GC-rich yeast genome (45.7%) appears phylogenetically related with the few other nitrate-assimilating yeasts sequenced so far, Ogataea polymorpha, O. parapolymorpha, and Dekkera bruxellensis, with which it shares a very reduced number of tRNA genes, a novel tRNA sparing strategy, and a common nitrate assimilation cluster, three specific features to this group of yeasts. Centromeres were recognized in GC-poor troughs of each scaffold. The strain bears MAT alpha genes at a single MAT locus and presents a significant degree of conservation with Saccharomyces cerevisiae genes, suggesting that it can perform sexual cycles in nature, although genes involved in meiosis were not all recognized. The complete absence of conservation of synteny between K. capsulata and any other yeast genome described so far, including the three other nitrate-assimilating species, validates the interest of this species for long-range evolutionary genomic studies among Saccharomycotina yeasts.

Phylogenomics Controlling for Base Compositional Bias Reveals a Single Origin of Eusociality in Corbiculate Bees.

As increasingly large molecular data sets are collected for phylogenomics, the conflicting phylogenetic signal among gene trees poses challenges to resolve some difficult nodes of the Tree of Life. Among these nodes, the phylogenetic position of the honey bees (Apini) within the corbiculate bee group remains controversial, despite its considerable importance for understanding the emergence and maintenance of eusociality. Here, we show that this controversy stems in part from pervasive phylogenetic conflicts among GC-rich gene trees. GC-rich genes typically have a high nucleotidic heterogeneity among species, which can induce topological conflicts among gene trees. When retaining only the most GC-homogeneous genes or using a nonhomogeneous model of sequence evolution, our analyses reveal a monophyletic group of the three lineages with a eusocial lifestyle (honey bees, bumble bees, and stingless bees). These phylogenetic relationships strongly suggest a single origin of eusociality in the corbiculate bees, with no reversal to solitary living in this group. To accurately reconstruct other important evolutionary steps across the Tree of Life, we suggest removing GC-rich and GC-heterogeneous genes from large phylogenomic data sets. Interpreted as a consequence of genome-wide variations in recombination rates, this GC effect can affect all taxa featuring GC-biased gene conversion, which is common in eukaryotes.