916 resultados para Fruit contamination
Resumo:
A rapid and reliable method for the determination of 25 compounds selected from four classes of pesticides in samples of fresh apples, grapes, pears, and strawberries purchased at a local supermarket, is presented. The study describes two different methods of extraction: solid-liquid extraction with acetone and supercritical fluid extraction. Clean-up was based on aminopropyl cartridge extraction followed by gas chromatography with an electron capture detector for simultaneous determinations. Confirmatory analysis was carried out by gas chromatography with mass spectrometry in the selected-ion monitoring (SIM) mode. Extraction efficiencies were directly compared and the methods were applied to the analysis of real samples. Recoveries for a majority of pesticides from standard samples at enrichment levels of 0.04-0.10 mg/ kg ranged from 77 to 96 % for both methods. The supercritical fluid extraction method showed good limits of detection (less than 0.01 mg/kg, depending on the pesticide and matrix) as well as minimizing environmental concerns, time, and laboratory effort. © 2006 Centro de Información Tecnológica.
Resumo:
2009
Resumo:
The present study was carried out to evaluate the effect of chitosan-based edible coatings with Aloe vera extract on the postharvest blueberry fruit quality during storage at 5 °C. Firstly, A. vera fractions (pulp and liquid) were extracted from leaves and evaluated in terms of antifungal and antioxidant capacities. The choice of the most adequate chitosan and A. vera fraction concentrations to be incorporated in coating formulation was made based on the wettability of the corresponding coating solutions. Coatings with 0.5% (w/v) chitosan + 0.5% (w/v) glycerol + 0.1% (w/v) Tween 80 + 0.5% (v/v) A. vera liquid fraction presented the best characteristics to uniformly coat blueberry surface. Physico-chemical (i.e., titratable acidity, pH, weight loss) and microbiological analyses of coated blueberries (non-inoculated or artificially inoculated with Botrytis cinerea) were performed during 25 d. Microbiological growth and water loss levels were approximately reduced by 50% and 42%, respectively, in coated blueberries after 25 d compared to uncoated blueberries. After 15 d, weight loss values were 6.2% and 3.7% for uncoated and chitosanA. vera coated blueberries, respectively. Uncoated fruits presented mold contamination after 2 d of storage (2.0 ± 0.32 log CFU g1), whilst fruits with chitosan-based coatings with A. vera presented mold contamination only after 9 d of storage (1.3 ± 0.35 log CFU g1). Overall, coatings developed in this study extend blueberries shelf-life for about 5 d, demonstrating for the first time that the combination of chitosan and A. vera liquid fraction as edible coating materials has great potential in expanding the shelf-life of fruits.
Resumo:
The analysis of alcoholic beverages for the important carcinogenic contaminant ethyl carbamate is very time-consuming and expensive. Due to possible matrix interferences, sample cleanup using diatomaceous earth (Extrelut) column is required prior to gas chromatographic and mass spectrometric measurement. A limiting step in this process is the rotary evaporation of the eluate containing the analyte in organic solvents, which is currently conducted manually and requires approximately 20-30 min per sample. This paper introduces the use of a parallel evaporation device for ethyl carbamate analysis, which allows for the simultaneous evaporation of 12 samples to a specified residual volume without manual intervention. A more efficient and, less expensive analysis is therefore possible. The method validation showed no differences between the fully-automated parallel evaporation and the manual operation. The applicability was proven by analyzing authentic spirit samples from Germany, Canada and Brazil. It is interesting to note that Brazilian cachacas had a relatively high incidence for ethyl carbamate contamination (55% of all samples were above 0.15 mg/l), which may be of public health relevance and requires further evaluation.
Resumo:
One hundred and eleven samples of processed fruit juices (apple, grape, pineapple, papaya, guava, banana and mango) and 38 samples of sound fruits (apple, papaya, mango, pear and peach) produced and marketed in Brazil, were analysed for patulin by HPLC. Only one out of 30 samples of apple juice was found positive at 17 μg/l. Patulin was not detected in the other foodstuffs. It was found in 14 samples of spoiled fruit samples of apple (150-267 μg/kg), pear (134-245 μg/kg) and peach (92-174 μg/kg). Confirmation of the identity of patulin was based on the UV spectrum obtained by the HPLC diode array detector, compared with that of standard patulin, TLC developed by several solvent systems and sprayed with 3-methyl-2-benzothiazolinone hydrazone, and by acetylation with acetic anhydride.
Resumo:
Cover title.
Resumo:
The morphology of the fruit and difficulties with fruit processing impose major limitations to germination of Persoonia sericea and P. virgata. The mesocarp must be removed without harming the embryo. Fermentation of fruit or manual removal of the mesocarp was effective but digestion in 32% hydrochloric acid (HCl) completely inhibited germination. The endocarp is extremely hard and therefore very difficult and time consuming to remove without damaging the seeds. The most efficient method was cracking the endocarp with pliers, followed by manual removal of seeds. Germination was completely inhibited unless at least half of the endocarp was removed. Microbial contamination of the fruit and seeds was controlled by disinfestation and germination of the seed under aseptic conditions. The results suggest that dormancy in these species is primarily due to physical restriction of the embryo by the hard endocarp.
Resumo:
Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.
Resumo:
Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.
Resumo:
In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.
Resumo:
The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.
Resumo:
One of the main objectives of applying edible coatings on fruits surface is to create a protective film to reduce weight loss due to evaporation and transpiration and also to decrease the risk of fruit rot caused by environmental contamination, in order to improve the visual aspect. Therefore, it is possible to increase shelf life, and decrease post harvest losses. Persimmon is a much appreciated fruit, with high potential for export, but sensitive to handling and storage. This study aimed to evaluate the effect of applying the edible coating Megh Wax ECF-124 (18% of active composts, consisting of emulsion of carnauba wax, anionic surfactant, preservative and water) produced by Megh Industry and Commerce Ltda in three different concentrations (25, 50 and 100%) on post harvest quality of 'Fuyu' persimmon stored for 14 days. The attributes evaluated for quality were: firmness, pH, acidity, soluble solids, weight loss and color. The results showed that application of carnauba wax in different concentrations was effective on decreasing weight loss of persimmon cv. Fuyu and maintenance of color aspects. Treatment at lower concentration, 25%, showed lower rate of discharge, but high concentrations showed lower values of mass loss. Carnauba wax application showed a high potential for use on postharvest conservation, and can be applied together with other technologies, helping to maintain quality for export.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
PURPOSE: The aim of this study was to assess the contamination status of endodontic absorbent paper points from sterilized or not sterilized commercial packs, as well as paper points exposed to the dental office environment. METHODS: Twenty absorbent paper points were evaluated for contamination status packed under different conditions: commercial/sterilized pack, commercial/non-sterilized pack, exposed to the clinical environment, and intentionally contaminated (positive control). Contamination was determined qualitatively and quantitatively by aerobiosis, capnophilic growth, and pour plate. The Petri dishes were analyzed with a colony counter, and the results were expressed as colony-forming units. The data were analyzed by Kruskal-Wallis test (α=0.05). RESULTS: No difference in colony-forming units was found among the groups of endodontic absorbent paper points. All groups were contaminated by fungi and bacteria. CONCLUSION: It can be concluded that the sterilization of absorbent endodontic paper points before clinical use should be recommended regardless of commercial presentation
Resumo:
Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.